Information

What is cognate miRNA?

What is cognate miRNA?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I understand what miRNA are, but I'm unsure of what cognate means. Looking at this post, it seems that a cognate miRNA is a known miRNA vs. a recently discovered/possible miRNA. Is this thinking on the right track?


The use of the word cognate in molecular biology reflects adjectival definition 2 from Lexico:

2 formal Related; connected.
'cognate subjects such as physics and chemistry'

The example given shows that this can be used in the most general sense of related, so that there is no requirement for some common antecedent as a surrogate for a human mother or ancestor.

Specifically there is no implication of the involvement of a common DNA sequence, as in the answer from @Dirigible, nor that of a common origin as invoked in an earlier answer on this topic.

This is quite clear if one considers the much earlier usage of cognate in molecular biology in relation to an mRNA codon and the tRNA anticodons that can recognize it, or a tRNA and an aminoacyl tRNA synthetase that can aminoacylate it.

As far as the usage with microRNAs is concerned, a cognate mRNA is one with which the miRNA can interact by base-pairing - no more, no less.


MicroRNAs

3 Genetic Organization, Variation in MicroRNAs, and Tissue-Specific Expression of MicroRNAs

MicroRNAs (miRNAs) undergo multiple processing events to reach their functional 21–23 ribonucleotide RNA sequence. Canonical miRNAs are generated from protein-coding transcriptional units whereas, other miRNAs (ie, noncanonical miRNAs) are generated from nonprotein-coding transcriptional units. In both cases, the miRNAs can be located either within intronic or exonic regions. A noteworthy mechanistic distinction in canonical versus noncanonical miRNAs is that canonical intronic miRNAs are Drosha dependent and are thus processed cotranscriptionally with protein-coding transcripts in the nucleus. The premiRNA then enters the miRNA pathway, whereas the rest of the transcript undergoes premRNA splicing to produce mature mRNA which will then direct protein synthesis. Noncanonical intronic small RNAs (also called mirtrons) can derive from small introns that resemble premiRNAs, and bypass the Drosha-processing step [11] . miRNAs tend to be organized in a related cluster and also tend to target multiple mRNA transcripts within common cellular response pathways (eg, proliferation, apoptosis). This organizational thematic provides miR clusters with a capacity for coordinate regulation of multiple steps within a pathway, providing an opportunity for complex and adaptive regulatory control of entire pathways. An interesting class of miRNAs is myomiRs—so-called because they are coded within myosin heavy chain (MYH) genes. myomiRs are transcribed in the same precursor mRNA as the parental MYH gene [4] . Of special note is the myomiR-499, which despite the absence of a parent mRNA, is one of the most highly expressed miRNAs in heart tissue. In an apparently novel evolutionary phenomenon, alternative splicing in the heart uncouples production of mature miR-499 from expression of parent MYH7b mRNA, meaning that the mRNA has perhaps evolved into a nonfunctional host mRNA for its intronic miR (ie, miR-499).

Comparative studies evaluating the organizational structure of the mammalian genome have identified a wealth of chromosomal insertion–deletions, copy number variants, and single nucleotide polymorphisms (SNPs) that, depending on the environmental context, contribute to the genetic variation that can underlay phenotypic diversity. This diversity is evident in nearly every aspect of human health and disease that has been investigated. Perhaps not surprisingly, there is now a growing recognition that variation in miRNAs and their target genes also contribute to this phenotypic variability. Several solid and hematologic malignancies can be linked to miRNAs located at amplified, deleted, or translocated chromosomal regions in the mammalian genome [12] . Variation in gene expression and regulation is likely influenced by genetic variants in cis- and trans-acting SNPs (also known as expression quantitative trait loci) [13] . An interesting observation of miRNA binding is their ability to recognize binding site polymorphism (miRSNPs) in transcribed functional genes. For example, miR-24 appears to be deregulated in human colorectal tumor through a target site polymorphism in the dihydrofolate reductase gene. In another example, a polymorphism within the myostatin gene creates a target site for miR-1 and miR-206, which are highly expressed in skeletal muscle. The binding of these miRs to the polymorphism in myostatin causes translational inhibition of myostatin transcripts and can phenocopy the observed muscle hypertrophy that is observed with genetic knockouts of the myostatin gene [14] . Given the significant differences in gene expression and genetic variation across human populations, analysis of the role of miRNAs in contributing to population differences in gene expression is likely to provide substantial insights in population based health disparities and physical functionalities [13] . Indeed, comparative genomic studies indicate that the target mRNA sequences for miRNAs: untranslated regions (UTRs) on mRNAs often display sequence diversity. This may suggest adaptive evolution of coexpressed miRNAs and cognate mRNAs with these UTR variants. Depending on whether the dampening of protein output is beneficial, inconsequential, or harmful, the UTR sites may be selectively conserved, neutral, or avoided during miRNA:mRNA coevolution [1] .

Studies evaluating the tissue-specific expression of miRNAs illustrate a “cross-regulation” feature of miRNAs that contributes to cell fate specification by repressing alternate cell fates to facilitate commitment to one cell fate and to maintain stability of a differentiated phenotype [15] . For example the myomiRs miR-1, miR-133, miR-206, miR-208, miR-486, and miR-499 are enriched in skeletal muscle and play crucial roles in the development, growth, and maintenance of skeletal muscle [16] . Notably, miR-133 prevents osteogenic cell lineage differentiation by repressing Runx2, a factor essential for bone formation [15] . MiR-7, miR-24, miR-128, miR-134, miR-219, and others are highly expressed in the mammalian brain and regulate neurite outgrowth, neuronal differentiation, and dendritic spine size [17] . Regionally enriched miRNAs in specific tissues can exert specialized function. For example, miR-7 and miR-24 are highly expressed in the hypothalamus and fine-tuning expression of Fos and oxytocin which play vital roles in the control of water, lactation, and parturition [18] .


Target-dependent biogenesis of cognate microRNAs in human cells

Extensive research has established how miRNAs regulate target mRNAs by translation repression and/or endonucleolytic degradation in metazoans. However, information related to the effect of target mRNA on biogenesis and stability of corresponding miRNAs in animals is limited. Here we report regulated biogenesis of cognate miRNAs by their target mRNAs. Enhanced pre-miRNA processing by AGO-associated DICER1 contributes to this increased miRNP formation. The processed miRNAs are loaded onto AGO2 to form functionally competent miRISCs both in vivo and also in a cell-free in vitro system. Thus, we identify an additional layer of posttranscriptional regulation that helps the cell to maintain requisite levels of mature forms of respective miRNAs by modulating their processing in a target-dependent manner, a process happening for miR-122 during stress reversal in human hepatic cells.

Conflict of interest statement

The authors declare no conflict of interests.

Figures

Figure 1. Reversal of amino acid-starvation-induced stress…

Figure 1. Reversal of amino acid-starvation-induced stress increases miR-122 biogenesis in Huh7 cells.

Figure 2. Target mRNA-dependent increase of mature…

Figure 2. Target mRNA-dependent increase of mature miR-122 in human cells.

Figure 3. Effect of target mRNA concentration…

Figure 3. Effect of target mRNA concentration on substrate-dependent miRNA increase in human cells.

Figure 4. Target mRNA drives increased biogenesis…

Figure 4. Target mRNA drives increased biogenesis of mature miRNA from pre-miRNA.

Figure 5. Increased activity of AGO2-associated DICER1…

Figure 5. Increased activity of AGO2-associated DICER1 contributes to the target mRNA-driven miRNA production.

Figure 6. Increased processivity of AGO2-associated DICER1…

Figure 6. Increased processivity of AGO2-associated DICER1 in the presence of target mRNA.


Trends in the development of miRNA bioinformatics tools

MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression via recognition of cognate sequences and interference of transcriptional, translational or epigenetic processes. Bioinformatics tools developed for miRNA study include those for miRNA prediction and discovery, structure, analysis and target prediction. We manually curated 95 review papers and ∼1000 miRNA bioinformatics tools published since 2003. We classified and ranked them based on citation number or PageRank score, and then performed network analysis and text mining (TM) to study the miRNA tools development trends. Five key trends were observed: (1) miRNA identification and target prediction have been hot spots in the past decade (2) manual curation and TM are the main methods for collecting miRNA knowledge from literature (3) most early tools are well maintained and widely used (4) classic machine learning methods retain their utility however, novel ones have begun to emerge (5) disease-associated miRNA tools are emerging. Our analysis yields significant insight into the past development and future directions of miRNA tools.

Keywords: bibliometric bioinformatics tools miRNA ranking text mining.

© The Author(s) 2018. Published by Oxford University Press.

Figures

miRNA biogenesis of animal/plant and…

miRNA biogenesis of animal/plant and bioinformatics tools associated within each process. The canonical…

Historical time line of miRNA…

Historical time line of miRNA research. The development of experimental and computational aspects…

Standardized miRNA analysis workflow and…

Standardized miRNA analysis workflow and examples of associated tools. The left panel with…

Circular graphic of miRNA identification…

Circular graphic of miRNA identification and miRNA target prediction mentioned in reviews since…

Statistic of miRNA tools. Line…

Statistic of miRNA tools. Line chart: The number of publications of ncRNA-related bioinformatics…

Tags statistic of miRNA tools…

Tags statistic of miRNA tools based on miRToolsGallery. Heat map for top tags…

Word cloud based on literature…

Word cloud based on literature in each year. The word cloud was generated…

ncRNA tools interaction network. The…

ncRNA tools interaction network. The left network was based on the tool’s publication…


Discussion

RIP and mRNPs

We used RIP in conjunction with either NanoString or high-throughput sequencing to examine endogenous mRNPs. One advantage of this approach is that it allows investigation of mRNAs and RNA-binding proteins expressed from their endogenous loci, and in so doing avoids over-expression of either the mRNA or protein components of mRNPs. Overexpression can lead to spurious binding and, thus, incorrect quantitative and qualitative definition of mRNP components relative to the endogenous situation in cells [75].

Despite these advantages, the RIP protocol includes in vitro incubation and washes that might perturb the native occupancies of some RNA-binding proteins. Although we modified the protocol to minimize the duration of the in vitro incubation, because we could not eliminate it altogether, the results that we report are for interactions that were sufficiently stable to survive these steps. Thus, any changes in the stability of interactions within an mRNP might have contributed, at least in part, to our observed changes in apparent occupancy. For example, apparent occupancy could have been inflated if remodeling of an mRNP added interactions that decreased the in vitro dissociation rate of the immunoprecipitated protein. Nonetheless, increasing the stability of an interaction often goes hand-in-hand with increasing its occupancy and, in either case, the result would reflect a change in the native mRNP. Overall, the correspondence between our results and those of previous approaches for studying miRNA-mediated regulation confirmed the utility of our approach, extended some of those previous results to endogenous mRNAs, and provided new insight into both miRNA-mediated repression and mRNP organization more generally.

MRNPs in miRNA-mediated repression

Association with eIF4E, eIF4G, and PABP is a hallmark of stable, translationally competent cytoplasmic mRNPs, and a variety of reporter-based studies implicate miRNA-mediated repression in altering association with these key factors [38, 47, 50, 51]. With these results in mind, miRNA-dependent depletion of PABP-bound mRNA, measured using PABP RIP-seq, has been used to identify miRNA targets in human cells, although this was done without distinguishing depletion caused by lowered PABP occupancy from depletion caused by mRNA destabilization [55]. Our study has extended these results to endogenous mRNPs on a transcriptome-wide scale, showing that even after taking into account changes in RNA abundance the loss of PABP and eIF4G is widespread during miRNA-mediated repression, despite the inherently dynamic and diverse nature of mRNPs. The remodeled mRNPs that lost PABP and eIF4G were presumably incapable of supporting translation initiation, consistent with reports of the importance of the eIF4F complex in miRNA-mediated translational repression [49, 51].

Despite the readily detectable miRNA-mediated dissociation of PABP and eIF4G, we were unable to detect miRNA-mediated dissociation of eIF4E, which could be a consequence of miRNA-targeted mRNAs that have lost eIF4E undergoing decapping and degradation too rapidly to be detected by our methods. This interpretation is challenged by the results of our transcriptome-wide analysis of eIF4E binding, which revealed a range of eIF4E occupancies that spanned > 100-fold (Fig. 5a), implying that many mRNAs lacking bound eIF4E are not immediately decapped and degraded. We propose that the solution to this apparent paradox rests squarely on the mRNP context—that dissociation of eIF4E might have very different consequences for some mRNAs compared to others. In this model, eIF4E dissociation is necessary for decapping [17] but is not sufficient, and additional mRNP alterations associated with miRNA targeting would favor both decapping and degradation. Such alterations might include dissociation of PABP, shortening of the poly(A) tail, or recruitment of decay factors [4], each of which has been observed during miRNA-mediated repression in the present study (Figs. 1 and 2) as well as previous reports [30, 38, 47].

With respect to decay factors that predispose mRNAs for decapping, a top candidate is DDX6. This protein interacts with the decapping complex through adaptor proteins [39, 45] and is implicated in miRNA-mediated repression of reporters [41, 43, 44]. Moreover, we found that DDX6 is recruited to many endogenous mRNAs as they became targeted by miRNAs and that DDX6 is associated with many additional mRNAs undergoing decay, which presumably are not being targeted by miRNAs. DDX6-bound transcripts have poly(A) tails that are on average significantly shorter than those of the steady-state population, suggesting that DDX6 recruitment coincides with deadenylation. This result is consistent with recruitment of DDX6 by the CCR4–NOT deadenylase complex via a direct interaction with CNOT1 [41, 43, 44]. Nonetheless, our analysis of poly(A)-tail lengths on miRNA-site-containing mRNAs indicates that the downstream recruitment of DDX6 is broadly similar in the presence and absence of the cognate miRNA. Together, our results support a model in which miRNA-mediated repression leads to the recruitment of the CCR4–NOT deadenylase complex via direct interactions with TNRC6 [31, 37] and, once the deadenylase has been recruited, the dense network of interactions between mRNA decay factors then leads to the ultimate destruction of the transcript through mechanisms that also act on many other mRNAs and, thus, are not directly orchestrated by the miRNA machinery [42, 61].

Organization of mRNPs: PABP and the poly(A) tail

PABP has long been recognized as a critical factor for post-transcriptional regulation and is essential for the ability of the poly(A) tail to stabilize transcripts. Consistent with this understanding, our results have demonstrated that increased PABP occupancy correlates with increased translatability and stability of the mRNA. The poly(A) tail has long been thought to be central in post-transcriptional regulation, with longer tails leading to increased stability and translation through their ability to bind more PABP. Unexpectedly, however, we found a lack of correlation between PABP occupancy and the length of the poly(A) tail, suggesting that the relationship between the poly(A)-tail length and PABP binding is more complex than previously thought. Indeed, although among transcripts derived from the same gene PABP occupancy was somewhat reduced for mRNAs with the shortest tails, differences in mean poly(A)-tail length could not explain differences in PABP occupancy observed for transcripts from different genes. Thus, although PABP might be critical for signaling that a poly(A) tail is present, in both human and fly cell lines and in yeast, PABP seems to be a very poor “reader” of poly(A)-tail length.

Recent studies have shown that, in contexts other than oocytes and early embryos, steady-state poly(A)-tail length fails to correlate with either mRNA stability or mRNA translation efficiency [36, 76]. These previous results can now be reconciled with the known roles of PABP in promoting mRNA stability and translation [15, 16, 77], in that we have shown here that differences in steady-state poly(A)-tail length do not necessarily cause differences in PABP occupancy.

Our results have also shown that the density of PABP along poly(A) tails can differ substantially for mRNAs from different genes. For instance, mRNAs for ribosomal proteins have very short poly(A) tails yet very high PABP occupancy. Although our current approach cannot determine the absolute number of PABPs bound to these mRNAs, our results are consistent with the density of PABP on these transcripts being higher than on other mRNAs. It will be interesting to explore this possibility further and to determine the extent to which PABP density influences deadenylation, decapping and/or other posttranscriptional processes.

What then might determine how much PABP is bound? Our results, together with those from Drosophila extracts [47], show that miRNA-mediated loss of PABP may just be the tip of the iceberg. The interplay among various regulatory factors, including miRNAs, and core factors, such as eIF4F, may determine the nature and composition of each mRNP, including the PABP occupancy of its constituent mRNAs. For instance, eIF4G can influence PABP affinity in vitro [78] and, thus, events in the 5′ UTR might have corresponding effects on PABP binding. This model is consistent with the numerous interactions described between PABP and other regulatory factors [22, 42, 66, 79]. Intrinsic mRNA features might also modulate PABP occupancy. For instance, because PABP can bind to AU-rich stretches with high affinity [80], differential binding to the 3′ end of the 3′ UTR, which can be quite AU-rich, might influence occupancy. Moreover, because PABP interacts with the termination factor eRF3, translation rate or termination efficiency might also have an impact on PABP binding [81]. Future insights into mRNP organization and remodeling will shed additional light on the mRNA features and factors that trump tail length to determine PABP occupancy.


Mechanisms of miRNA-Mediated Gene Regulation

Most studies to date have shown that miRNAs bind to a specific sequence at the 3′ UTR of their target mRNAs to induce translational repression and mRNA deadenylation and decapping (40, 41). miRNA binding sites have also been detected in other mRNA regions including the 5′ UTR and coding sequence, as well as within promoter regions (42). The binding of miRNAs to 5′ UTR and coding regions have silencing effects on gene expression (43, 44) while miRNA interaction with promoter region has been reported to induce transcription (45). However, more studies are required to fully understand the functional significance of such mode of interaction.

MicroRNA-Mediated Gene Silencing via miRISC

The minimal miRNA-induced silencing complex (miRISC) consists of the guide strand and AGO (46). The target specificity of miRISC is due to its interaction with complementary sequences on target mRNA, called miRNA response elements (MREs). The degree of MRE complementarity determines whether there is AGO2-dependent slicing of target mRNA or miRISC-mediated translational inhibition and target mRNA decay (47). A fully complementary miRNA:MRE interaction induces AGO2 endonuclease activity and targets mRNA cleavage (47). However, this interaction destabilizes the association between AGO and the 3′ end of the miRNA promoting its degradation (48, 49).

In animal cells, the majority of miRNA:MRE interactions are not fully complementary (50). Most MREs contain at least central mismatches to their guide miRNA, preventing AGO2 endonuclease activity. Consequently, AGO2 acts as a mediator of RNA interference, similar to the non-endonucleolytic AGO family members (AGO1, 3, and 4 in humans). In many cases, a functional miRNA:MRE interaction occurs via the 5' seed region (nucleotides 2𠄸) (42, 51). However, additional paring at the 3′ end aids in the stability and specificity of the miRNA-target interaction (15).

The formation of a silencing miRISC complex starts with the recruitment of the GW182 family of proteins by miRISC GW182 provides the scaffolding needed to recruit other effector proteins (52), such as the poly(A)-deadenylase complexes PAN2-PAN3 and CCR4-NOT, following miRNA:target mRNA interaction (50, 53). Target mRNA poly(A)-deadenylation is initiated by PAN2/3 and completed by the CCR4-NOT complex. The interaction between the tryptophan (W)-repeats of GW182 and poly(A)-binding protein C (PABPC) promotes efficient deadenylation (50). Subsequently, decapping takes place facilitated by decapping protein 2 (DCP2) and associated proteins (52), followed by 5′𢄣′ degradation by exoribonuclease 1 (XRN1) (54) (Figure 1).

MicroRNA-Mediated Translational Activation

Although most studies are focused on how miRNAs inhibit gene expression, some have also reported up-regulation of gene expression by miRNAs. In serum starved cells, AGO2 and another protein related to the miRNA-protein complex (microRNPs), Fragile-x-mental retardation related protein 1 (FXR1), were associated with AU-rich elements (AREs) at 3′ UTR to activate translation (55). Several miRNAs, including let-7, were found to be associated with AGO2 and FXR1 to activate translation during cell cycle arrest, but they inhibit translation in proliferating cells (55). Upregulation of gene expression by miRNAs was also observed in quiescent cells, such as oocytes (56, 57). The miRNA-mediated activation of translation involves AGO2 and FXR1 instead of GW182 (56). Other examples of gene activation by miRNAs include binding to the 5′ UTR of mRNAs encoding ribosomal proteins during amino acid starvation (58) thus suggesting that miRNA-mediated upregulation of gene expression occurs under specific conditions.

MicroRNA-Mediated Transcriptional and Post-transcriptional Gene Regulation Within the Nucleus

Through Importin-8 or Exportin-1, human AGO2 shuttles between the nucleus and cytoplasm via its interaction with TNRC6A (a GW182 family protein) which contains a nuclear localization and export signal (59). Nuclear localized miRISC was found to regulate both transcriptional rates and post-transcriptional levels of mRNA (59�) and associate with euchromatin at gene loci with active transcription (62). However, our understanding of when and how miRNAs exert their functions in the nucleus is still limited.

It has been reported that low molecular weight miRISC can interact with mRNAs within the nucleus and induce nuclear mRNA degradation, although the mechanism behind this is unclear (59, 61, 63). Enrichment of miRNA at actively transcribed genes may suggest that miRISC interacts with target mRNA co-/post-transcriptionally. The involvement of AGO and Drosha in mRNA splicing (64, 65) further supports co-transcriptional miRISC:mRNA interactions. miRISC may also regulate transcription directly. A study showed that AGO2 was concentrated in the nucleus of senesced fibroblasts and interacted with miRISC and retinoblastoma (Rb) to suppress the transcription of proliferation-promoting genes regulated by Rb/E2F. It was noted that let-7f was bound to MREs found in the promoters of two E2F target genes, CDCA8 and CDC2, in an AGO2-dependent manner (60). Also, a subset of AGO-promoter bound genes was upregulated following senescence, and AGO2 was found to co-immunoprecipitate with euchromatin (60). A more recent study by Miao et al. (66) found nuclear miR-522 interacting with a DNA cruciform structure (a stem-loop on sense and antisense DNA strands) within the promoter of CYP2E1 and suppressing its transcription (66). miRNAs have also been shown to interact at genomic loci, where enhancer-derived RNA (eRNA) are transcribed, and increase mRNA levels of adjacent genes by promoting a transcriptionally active chromatin state (67) while altering alternative splicing profiles (64). The overall role of miRISC in the regulation of chromatin state and structure and transcriptional control remain to be determined, but these current data suggest a transcription factor-like role. It is also possible that miRISC may be involved in the establishment of de novo methylation, and by extension, the compactification of chromatin into nuclear compartments, and mediation of genomic remodeling.


References

Ghildiyal, M. & Zamore, P. D. Small silencing RNAs: an expanding universe. Nature Rev. Genet. 10, 94–108 (2009).

Ishizu, H., Siomi, H. & Siomi, M. C. Biology of PIWI-interacting RNAs: new insights into biogenesis and function inside and outside of germlines. Genes Dev. 26, 2361–2373 (2012).

Huntzinger, E. & Izaurralde, E. Gene silencing by microRNAs: contributions of translational repression and mRNA decay. Nature Rev. Genet. 12, 99–110 (2011).

Bartel, D. P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215–233 (2009).

Friedman, R. C., Farh, K. K., Burge, C. B. & Bartel, D. P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 19, 92–105 (2009).

Lujambio, A. & Lowe, S. W. The microcosmos of cancer. Nature 482, 347–355 (2012).

Im, H. I. & Kenny, P. J. MicroRNAs in neuronal function and dysfunction. Trends Neurosci. 35, 325–334 (2012).

Kim, V. N., Han, J. & Siomi, M. C. Biogenesis of small RNAs in animals. Nature Rev. Mol. Cell Biol. 10, 126–139 (2009).

Krol, J., Loedige, I. & Filipowicz, W. The widespread regulation of microRNA biogenesis, function and decay. Nature Rev. Genet. 11, 597–610 (2010).

Siomi, H. & Siomi, M. C. Posttranscriptional regulation of microRNA biogenesis in animals. Mol. Cell 38, 323–332 (2010).

Axtell, M. J., Westholm, J. O. & Lai, E. C. Vive la difference: biogenesis and evolution of microRNAs in plants and animals. Genome Biol. 12, 221 (2011).

Cuperus, J. T., Fahlgren, N. & Carrington, J. C. Evolution and functional diversification of miRNA genes. Plant Cell 23, 431–442 (2011).

Voinnet, O. Origin, biogenesis, and activity of plant microRNAs. Cell 136, 669–687 (2009).

Chang, S. S., Zhang, Z. & Liu, Y. RNA interference pathways in fungi: mechanisms and functions. Annu. Rev. Microbiol. 66, 305–323 (2012).

Griffiths-Jones, S., Saini, H. K., van Dongen, S. & Enright, A. J. miRBase: tools for microRNA genomics. Nucleic Acids Res. 36, D154–D158 (2008).

Chiang, H. R. et al. Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Genes Dev. 24, 992–1009 (2010).

Kozomara, A. & Griffiths-Jones, S. miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res 42, D68–D73 (2014).

Hertel, J. et al. The expansion of the metazoan microRNA repertoire. BMC Genomics 7, 25 (2006).

Berezikov, E. Evolution of microRNA diversity and regulation in animals. Nature Rev. Genet. 12, 846–860 (2011).

Wheeler, B. M. et al. The deep evolution of metazoan microRNAs. Evol. Dev. 11, 50–68 (2009).

Ventura, A. et al. Targeted deletion reveals essential and overlapping functions of the miR-17 through 92 family of miRNA clusters. Cell 132, 875–886 (2008).

Kim, Y. K. et al. TALEN-based knockout library for human microRNAs. Nature Struct. Mol. Biol. 20, 1458–1464 (2013).

Lee, Y., Jeon, K., Lee, J. T., Kim, S. & Kim, V. N. MicroRNA maturation: stepwise processing and subcellular localization. EMBO J. 21, 4663–4670 (2002).

Roush, S. & Slack, F. J. The let-7 family of microRNAs. Trends Cell Biol. 18, 505–516 (2008).

Ozsolak, F. et al. Chromatin structure analyses identify miRNA promoters. Genes Dev. 22, 3172–3183 (2008).

Monteys, A. M. et al. Structure and activity of putative intronic miRNA promoters. RNA 16, 495–505 (2010).

Cai, X., Hagedorn, C. H. & Cullen, B. R. Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs. RNA 10, 1957–1966 (2004).

Lee, Y. et al. MicroRNA genes are transcribed by RNA polymerase II. EMBO J. 23, 4051–4060 (2004).

Pfeffer, S. et al. Identification of microRNAs of the herpesvirus family. Nature Methods 2, 269–276 (2005).

Babiarz, J. E., Ruby, J. G., Wang, Y., Bartel, D. P. & Blelloch, R. Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs. Genes Dev. 22, 2773–2785 (2008).

Davis-Dusenbery, B. N. & Hata, A. Mechanisms of control of microRNA biogenesis. J. Biochem. 148, 381–392 (2010).

Lee, Y. et al. The nuclear RNase III Drosha initiates microRNA processing. Nature 425, 415–419 (2003).

Denli, A. M., Tops, B. B., Plasterk, R. H., Ketting, R. F. & Hannon, G. J. Processing of primary microRNAs by the Microprocessor complex. Nature 432, 231–235 (2004).

Gregory, R. I. et al. The Microprocessor complex mediates the genesis of microRNAs. Nature 432, 235–240 (2004).

Han, J. et al. The Drosha–DGCR8 complex in primary microRNA processing. Genes Dev. 18, 3016–3027 (2004).

Landthaler, M., Yalcin, A. & Tuschl, T. The human DiGeorge syndrome critical region gene 8 and its D. melanogaster homolog are required for miRNA biogenesis. Curr. Biol. 14, 2162–2167 (2004).

Chong, M. M. et al. Canonical and alternate functions of the microRNA biogenesis machinery. Genes Dev. 24, 1951–1960 (2010).

Wang, Y., Medvid, R., Melton, C., Jaenisch, R. & Blelloch, R. DGCR8 is essential for microRNA biogenesis and silencing of embryonic stem cell self-renewal. Nature Genet. 39, 380–385 (2007).

Shiohama, A., Sasaki, T., Noda, S., Minoshima, S. & Shimizu, N. Molecular cloning and expression analysis of a novel gene DGCR8 located in the DiGeorge syndrome chromosomal region. Biochem. Biophys. Res. Commun. 304, 184–190 (2003).

Goldberg, R., Motzkin, B., Marion, R., Scambler, P. J. & Shprintzen, R. J. Velo-cardio-facial syndrome: a review of 120 patients. Am. J. Med. Genet. 45, 313–319 (1993).

Filippov, V., Solovyev, V., Filippova, M. & Gill, S. S. A novel type of RNase III family proteins in eukaryotes. Gene 245, 213–221 (2000).

Fortin, K. R., Nicholson, R. H. & Nicholson, A. W. Mouse ribonuclease III. cDNA structure, expression analysis, and chromosomal location. BMC Genomics 3, 26 (2002).

Wu, H., Xu, H., Miraglia, L. J. & Crooke, S. T. Human RNase III is a 160-kDa protein involved in preribosomal RNA processing. J. Biol. Chem. 275, 36957–36965 (2000).

Tang, X., Zhang, Y., Tucker, L. & Ramratnam, B. Phosphorylation of the RNase III enzyme Drosha at Serine300 or Serine302 is required for its nuclear localization. Nucleic Acids Res. 38, 6610–6619 (2010).

Blaszczyk, J. et al. Crystallographic and modeling studies of RNase III suggest a mechanism for double-stranded RNA cleavage. Structure 9, 1225–1236 (2001).

Zhang, H., Kolb, F. A., Jaskiewicz, L., Westhof, E. & Filipowicz, W. Single processing center models for human Dicer and bacterial RNase III. Cell 118, 57–68 (2004).

Shiohama, A., Sasaki, T., Noda, S., Minoshima, S. & Shimizu, N. Nucleolar localization of DGCR8 and identification of eleven DGCR8-associated proteins. Exp. Cell Res. 313, 4196–4207 (2007).

Yeom, K. H., Lee, Y., Han, J., Suh, M. R. & Kim, V. N. Characterization of DGCR8/Pasha, the essential cofactor for Drosha in primary miRNA processing. Nucleic Acids Res. 34, 4622–4629 (2006).

Han, J. et al. Molecular basis for the recognition of primary microRNAs by the Drosha–DGCR8 complex. Cell 125, 887–901 (2006).

Sohn, S. Y. et al. Crystal structure of human DGCR8 core. Nature Struct. Mol. Biol. 14, 847–853 (2007).

Faller, M., Matsunaga, M., Yin, S., Loo, J. A. & Guo, F. Heme is involved in microRNA processing. Nature Struct. Mol. Biol. 14, 23–29 (2007).

Faller, M. et al. DGCR8 recognizes primary transcripts of microRNAs through highly cooperative binding and formation of higher-order structures. RNA 16, 1570–1583 (2010).

Barr, I. et al. Ferric, not ferrous, heme activates RNA-binding protein DGCR8 for primary microRNA processing. Proc. Natl Acad. Sci. USA 109, 1919–1924 (2012).

Weitz, S. H., Gong, M., Barr, I., Weiss, S. & Guo, F. Processing of microRNA primary transcripts requires heme in mammalian cells. Proc. Natl Acad. Sci. USA 111, 1861–1866 (2014).

Zeng, Y., Yi, R. & Cullen, B. R. Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. EMBO J. 24, 138–148 (2005).

Auyeung, V. C., Ulitsky, I., McGeary, S. E. & Bartel, D. P. Beyond secondary structure: primary-sequence determinants license pri-miRNA hairpins for processing. Cell 152, 844–858 (2013).

Ma, H., Wu, Y., Choi, J. G. & Wu, H. Lower and upper stem-single-stranded RNA junctions together determine the Drosha cleavage site. Proc. Natl Acad. Sci. USA 110, 20687–20692 (2013).

Mori, M. et al. Hippo signaling regulates Microprocessor and links cell-density-dependent miRNA biogenesis to cancer. Cell 156, 893–906 (2014).

Kim, Y. K. & Kim, V. N. Processing of intronic microRNAs. EMBO J. 26, 775–783 (2007).

Morlando, M. et al. Primary microRNA transcripts are processed co-transcriptionally. Nature Struct. Mol. Biol. 15, 902–909 (2008).

Pawlicki, J. M. & Steitz, J. A. Primary microRNA transcript retention at sites of transcription leads to enhanced microRNA production. J. Cell Biol. 182, 61–76 (2008).

Han, J. et al. Posttranscriptional crossregulation between Drosha and DGCR8. Cell 136, 75–84 (2009).

Sundaram, G. M. et al. 'See-saw' expression of microRNA-198 and FSTL1 from a single transcript in wound healing. Nature 495, 103–106 (2013).

Knuckles, P. et al. Drosha regulates neurogenesis by controlling neurogenin 2 expression independent of microRNAs. Nature Neurosci. 15, 962–969 (2012).

Kadener, S. et al. Genome-wide identification of targets of the drosha-pasha/DGCR8 complex. RNA 15, 537–545 (2009).

Herbert, K. M., Pimienta, G., DeGregorio, S. J., Alexandrov, A. & Steitz, J. A. Phosphorylation of DGCR8 increases its intracellular stability and induces a progrowth miRNA profile. Cell Rep. 5, 1070–1081 (2013).

Tang, X., Li, M., Tucker, L. & Ramratnam, B. Glycogen synthase kinase 3 beta (GSK3β) phosphorylates the RNAase III enzyme Drosha at S300 and S302. PLoS ONE 6, e20391 (2011).

Wada, T., Kikuchi, J. & Furukawa, Y. Histone deacetylase 1 enhances microRNA processing via deacetylation of DGCR8. EMBO Rep. 13, 142–149 (2012).

Tang, X. et al. Acetylation of drosha on the N-terminus inhibits its degradation by ubiquitination. PLoS ONE 8, e72503 (2013).

Cheng, T. L. et al. MeCP2 suppresses nuclear microRNA processing and dendritic growth by regulating the DGCR8/Drosha complex. Dev. Cell 28, 547–560 (2014).

Fukuda, T. et al. DEAD-box RNA helicase subunits of the Drosha complex are required for processing of rRNA and a subset of microRNAs. Nature Cell Biol. 9, 604–611 (2007).

Davis, B. N., Hilyard, A. C., Lagna, G. & Hata, A. SMAD proteins control DROSHA-mediated microRNA maturation. Nature 454, 56–61 (2008).

Davis, B. N., Hilyard, A. C., Nguyen, P. H., Lagna, G. & Hata, A. Smad proteins bind a conserved RNA sequence to promote microRNA maturation by Drosha. Mol. Cell 39, 373–384 (2010).

Suzuki, H. I. et al. Modulation of microRNA processing by p53. Nature 460, 529–533 (2009).

Di Carlo, V. et al. TDP-43 regulates the microprocessor complex activity during in vitro neuronal differentiation. Mol. Neurobiol. 48, 952–963 (2013).

Kawahara, Y. & Mieda-Sato, A. TDP-43 promotes microRNA biogenesis as a component of the Drosha and Dicer complexes. Proc. Natl Acad. Sci. USA 109, 3347–3352 (2012).

Guil, S. & Caceres, J. F. The multifunctional RNA-binding protein hnRNP A1 is required for processing of miR-18a. Nature Struct. Mol. Biol. 14, 591–596 (2007).

Michlewski, G., Guil, S., Semple, C. A. & Caceres, J. F. Posttranscriptional regulation of miRNAs harboring conserved terminal loops. Mol. Cell 32, 383–393 (2008).

Trabucchi, M. et al. The RNA-binding protein KSRP promotes the biogenesis of a subset of microRNAs. Nature 459, 1010–1014 (2009).

Bohnsack, M. T. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 10, 185–191 (2004).

Lund, E., Guttinger, S., Calado, A., Dahlberg, J. E. & Kutay, U. Nuclear export of microRNA precursors. Science 303, 95–98 (2004).

Yi, R., Qin, Y., Macara, I. G. & Cullen, B. R. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev. 17, 3011–3016 (2003).

Okada, C. et al. A high-resolution structure of the pre-microRNA nuclear export machinery. Science 326, 1275–1279 (2009).

Gwizdek, C. et al. Exportin-5 mediates nuclear export of minihelix-containing RNAs. J. Biol. Chem. 278, 5505–5508 (2003).

Zeng, Y. & Cullen, B. R. Structural requirements for pre-microRNA binding and nuclear export by Exportin 5. Nucleic Acids Res. 32, 4776–4785 (2004).

Iwasaki, Y. W. et al. Global microRNA elevation by inducible Exportin 5 regulates cell cycle entry. RNA 19, 490–497 (2013).

Wan, G. et al. DNA-damage-induced nuclear export of precursor microRNAs is regulated by the ATM–AKT pathway. Cell Rep. 3, 2100–2112 (2013).

Melo, S. A. et al. A genetic defect in exportin-5 traps precursor microRNAs in the nucleus of cancer cells. Cancer Cell 18, 303–315 (2010).

Xie, M. et al. Mammalian 5′-capped microRNA precursors that generate a single microRNA. Cell 155, 1568–1580 (2013).

Bernstein, E., Caudy, A. A., Hammond, S. M. & Hannon, G. J. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363–366 (2001).

Grishok, A. et al. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106, 23–34 (2001).

Hutvagner, G. et al. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293, 834–838 (2001).

Ketting, R. F. et al. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev. 15, 2654–2659 (2001).

Knight, S. W. & Bass, B. L. A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in Caenorhabditis elegans. Science 293, 2269–2271 (2001).

Lee, Y. S. et al. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell 117, 69–81 (2004).

Xie, Z. et al. Genetic and functional diversification of small RNA pathways in plants. PLoS Biol. 2, E104 (2004).

Bernstein, E. et al. Dicer is essential for mouse development. Nature Genet. 35, 215–217 (2003).

Kanellopoulou, C. et al. Dicer-deficient mouse embryonic stem cells are defective in differentiation and centromeric silencing. Genes Dev. 19, 489–501 (2005).

Murchison, E. P., Partridge, J. F., Tam, O. H., Cheloufi, S. & Hannon, G. J. Characterization of Dicer-deficient murine embryonic stem cells. Proc. Natl Acad. Sci. USA 102, 12135–12140 (2005).

Yang, J. S. & Lai, E. C. Alternative miRNA biogenesis pathways and the interpretation of core miRNA pathway mutants. Mol. Cell 43, 892–903 (2011).

Kumar, M. S. et al. Dicer1 functions as a haploinsufficient tumor suppressor. Genes Dev. 23, 2700–2704 (2009).

Tsutsumi, A., Kawamata, T., Izumi, N., Seitz, H. & Tomari, Y. Recognition of the pre-miRNA structure by Drosophila Dicer-1. Nature Struct. Mol. Biol. 18, 1153–1158 (2011).

Gu, S. et al. The loop position of shRNAs and pre-miRNAs is critical for the accuracy of dicer processing in vivo. Cell 151, 900–911 (2012).

Macrae, I. J. et al. Structural basis for double-stranded RNA processing by Dicer. Science 311, 195–198 (2006).

Park, J. E. et al. Dicer recognizes the 5′ end of RNA for efficient and accurate processing. Nature 475, 201–205 (2011).

Tian, Y. et al. A phosphate-binding pocket within the platform-PAZ-connector helix cassette of human Dicer. Mol. Cell 53, 606–616 (2014).

Lau, P. W., Potter, C. S., Carragher, B. & MacRae, I. J. Structure of the human Dicer–TRBP complex by electron microscopy. Structure 17, 1326–1332 (2009).

Taylor, D. W. et al. Substrate-specific structural rearrangements of human Dicer. Nature Struct. Mol. Biol. 20, 662–670 (2013).

Wang, H. W. et al. Structural insights into RNA processing by the human RISC-loading complex. Nature Struct. Mol. Biol. 16, 1148–1153 (2009).

MacRae, I. J., Zhou, K. & Doudna, J. A. Structural determinants of RNA recognition and cleavage by Dicer. Nature Struct. Mol. Biol. 14, 934–940 (2007).

Vermeulen, A. et al. The contributions of dsRNA structure to Dicer specificity and efficiency. RNA 11, 674–682 (2005).

Zhang, H., Kolb, F. A., Brondani, V., Billy, E. & Filipowicz, W. Human Dicer preferentially cleaves dsRNAs at their termini without a requirement for ATP. EMBO J. 21, 5875–5885 (2002).

Forstemann, K. et al. Normal microRNA maturation and germ-line stem cell maintenance requires Loquacious, a double-stranded RNA-binding domain protein. PLoS Biol. 3, e236 (2005).

Jiang, F. et al. Dicer-1 and R3D1-L catalyze microRNA maturation in Drosophila. Genes Dev. 19, 1674–1679 (2005).

Saito, K., Ishizuka, A., Siomi, H. & Siomi, M. C. Processing of pre-microRNAs by the Dicer-1-Loquacious complex in Drosophila cells. PLoS Biol. 3, e235 (2005).

Fukunaga, R. et al. Dicer partner proteins tune the length of mature miRNAs in flies and mammals. Cell 151, 533–546 (2012).

Liu, X. et al. Dicer-1, but not Loquacious, is critical for assembly of miRNA-induced silencing complexes. RNA 13, 2324–2329 (2007).

Park, J. K., Liu, X., Strauss, T. J., McKearin, D. M. & Liu, Q. The miRNA pathway intrinsically controls self-renewal of Drosophila germline stem cells. Curr. Biol. 17, 533–538 (2007).

Chendrimada, T. P. et al. TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 436, 740–744 (2005).

Haase, A. D. et al. TRBP, a regulator of cellular PKR and HIV-1 virus expression, interacts with Dicer and functions in RNA silencing. EMBO Rep. 6, 961–967 (2005).

Lee, Y. et al. The role of PACT in the RNA silencing pathway. EMBO J. 25, 522–532 (2006).

Lee, H. Y., Zhou, K., Smith, A. M., Noland, C. L. & Doudna, J. A. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Nucleic Acids Res. 41, 6568–6576 (2013).

Chakravarthy, S., Sternberg, S. H., Kellenberger, C. A. & Doudna, J. A. Substrate-specific kinetics of Dicer-catalyzed RNA processing. J. Mol. Biol. 404, 392–402 (2010).

Lee, H. Y. & Doudna, J. A. TRBP alters human precursor microRNA processing in vitro. RNA 18, 2012–2019 (2012).

Garcia, M. A., Meurs, E. F. & Esteban, M. The dsRNA protein kinase PKR: virus and cell control. Biochimie 89, 799–811 (2007).

Paroo, Z., Ye, X., Chen, S. & Liu, Q. Phosphorylation of the human microRNA-generating complex mediates MAPK/Erk signaling. Cell 139, 112–122 (2009).

Melo, S. A. et al. A TARBP2 mutation in human cancer impairs microRNA processing and DICER1 function. Nature Genet. 41, 365–370 (2009).

Tokumaru, S., Suzuki, M., Yamada, H., Nagino, M. & Takahashi, T. let-7 regulates Dicer expression and constitutes a negative feedback loop. Carcinogenesis 29, 2073–2077 (2008).

Forman, J. J., Legesse-Miller, A. & Coller, H. A. A search for conserved sequences in coding regions reveals that the let-7 microRNA targets Dicer within its coding sequence. Proc. Natl Acad. Sci. USA 105, 14879–14884 (2008).

Hammond, S. M., Boettcher, S., Caudy, A. A., Kobayashi, R. & Hannon, G. J. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293, 1146–1150 (2001).

Mourelatos, Z. et al. miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev. 16, 720–728 (2002).

Tabara, H. et al. The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99, 123–132 (1999).

Kawamata, T. & Tomari, Y. Making RISC. Trends Biochem. Sci. 35, 368–376 (2010).

Elkayam, E. et al. The structure of human Argonaute-2 in complex with miR-20a. Cell 150, 100–110 (2012).

Nakanishi, K., Weinberg, D. E., Bartel, D. P. & Patel, D. J. Structure of yeast Argonaute with guide RNA. Nature 486, 368–374 (2012).

Schirle, N. T. & MacRae, I. J. The crystal structure of human Argonaute2. Science 336, 1037–1040 (2012).

Song, J. J., Smith, S. K., Hannon, G. J. & Joshua-Tor, L. Crystal structure of Argonaute and its implications for RISC slicer activity. Science 305, 1434–1437 (2004).

Ma, J. B. et al. Structural basis for 5′-end-specific recognition of guide RNA by the A. fulgidus Piwi protein. Nature 434, 666–670 (2005).

Parker, J. S., Roe, S. M. & Barford, D. Structural insights into mRNA recognition from a PIWI domain-siRNA guide complex. Nature 434, 663–666 (2005).

Wang, Y., Sheng, G., Juranek, S., Tuschl, T. & Patel, D. J. Structure of the guide-strand-containing argonaute silencing complex. Nature 456, 209–213 (2008).

Frank, F., Sonenberg, N. & Nagar, B. Structural basis for 5′-nucleotide base-specific recognition of guide RNA by human AGO2. Nature 465, 818–822 (2010).

Wang, Y. et al. Structure of an argonaute silencing complex with a seed-containing guide DNA and target RNA duplex. Nature 456, 921–926 (2008).

Wang, Y. et al. Nucleation, propagation and cleavage of target RNAs in Ago silencing complexes. Nature 461, 754–761 (2009).

Liu, J. et al. Argonaute2 is the catalytic engine of mammalian RNAi. Science 305, 1437–1441 (2004).

Cheloufi, S., Dos Santos, C. O., Chong, M. M. & Hannon, G. J. A dicer-independent miRNA biogenesis pathway that requires Ago catalysis. Nature 465, 584–589 (2010).

Su, H., Trombly, M. I., Chen, J. & Wang, X. Essential and overlapping functions for mammalian Argonautes in microRNA silencing. Genes Dev. 23, 304–317 (2009).

Modzelewski, A. J., Holmes, R. J., Hilz, S., Grimson, A. & Cohen, P. E. AGO4 regulates entry into meiosis and influences silencing of sex chromosomes in the male mouse germline. Dev. Cell 23, 251–264 (2012).

Forstemann, K., Horwich, M. D., Wee, L., Tomari, Y. & Zamore, P. D. Drosophila microRNAs are sorted into functionally distinct argonaute complexes after production by dicer-1. Cell 130, 287–297 (2007).

Okamura, K., Ishizuka, A., Siomi, H. & Siomi, M. C. Distinct roles for Argonaute proteins in small RNA-directed RNA cleavage pathways. Genes Dev. 18, 1655–1666 (2004).

Tomari, Y., Du, T. & Zamore, P. D. Sorting of Drosophila small silencing RNAs. Cell 130, 299–308 (2007).

Czech, B. et al. Hierarchical rules for Argonaute loading in Drosophila. Mol. Cell 36, 445–456 (2009).

Ghildiyal, M., Xu, J., Seitz, H., Weng, Z. & Zamore, P. D. Sorting of Drosophila small silencing RNAs partitions microRNA * strands into the RNA interference pathway. RNA 16, 43–56 (2010).

Kawamata, T., Seitz, H. & Tomari, Y. Structural determinants of miRNAs for RISC loading and slicer-independent unwinding. Nature Struct. Mol. Biol. 16, 953–960 (2009).

Okamura, K., Liu, N. & Lai, E. C. Distinct mechanisms for microRNA strand selection by Drosophila Argonautes. Mol. Cell 36, 431–444 (2009).

Jannot, G., Boisvert, M. E., Banville, I. H. & Simard, M. J. Two molecular features contribute to the Argonaute specificity for the microRNA and RNAi pathways in C. elegans. RNA 14, 829–835 (2008).

Steiner, F. A. et al. Structural features of small RNA precursors determine Argonaute loading in Caenorhabditis elegans. Nature Struct. Mol. Biol. 14, 927–933 (2007).

Azuma-Mukai, A. et al. Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing. Proc. Natl Acad. Sci. USA 105, 7964–7969 (2008).

Meister, G. et al. Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol. Cell 15, 185–197 (2004).

Dueck, A., Ziegler, C., Eichner, A., Berezikov, E. & Meister, G. microRNAs associated with the different human Argonaute proteins. Nucleic Acids Res. 40, 9850–9862 (2012).

Yoda, M. et al. ATP-dependent human RISC assembly pathways. Nature Struct. Mol. Biol. 17, 17–23 (2010).

Liu, Y. et al. C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation. Science 325, 750–753 (2009).

Pham, J. W., Pellino, J. L., Lee, Y. S., Carthew, R. W. & Sontheimer, E. J. A Dicer-2-dependent 80s complex cleaves targeted mRNAs during RNAi in Drosophila. Cell 117, 83–94 (2004).

Tomari, Y. et al. RISC assembly defects in the Drosophila RNAi mutant armitage. Cell 116, 831–841 (2004).

Gregory, R. I., Chendrimada, T. P., Cooch, N. & Shiekhattar, R. Human RISC couples microRNA biogenesis and posttranscriptional gene silencing. Cell 123, 631–640 (2005).

MacRae, I. J., Ma, E., Zhou, M., Robinson, C. V. & Doudna, J. A. In vitro reconstitution of the human RISC-loading complex. Proc. Natl Acad. Sci. USA 105, 512–517 (2008).

Maniataki, E. & Mourelatos, Z. A human, ATP-independent, RISC assembly machine fueled by pre-miRNA. Genes Dev. 19, 2979–2990 (2005).

Miyoshi, K., Tsukumo, H., Nagami, T., Siomi, H. & Siomi, M. C. Slicer function of Drosophila Argonautes and its involvement in RISC formation. Genes Dev. 19, 2837–2848 (2005).

Gredell, J. A., Dittmer, M. J., Wu, M., Chan, C. & Walton, S. P. Recognition of siRNA asymmetry by TAR RNA binding protein. Biochemistry 49, 3148–3155 (2010).

Noland, C. L., Ma, E. & Doudna, J. A. siRNA repositioning for guide strand selection by human Dicer complexes. Mol. Cell 43, 110–121 (2011).

Liu, X., Jin, D. Y., McManus, M. T. & Mourelatos, Z. Precursor microRNA-programmed silencing complex assembly pathways in mammals. Mol. Cell 46, 507–517 (2012).

Betancur, J. G. & Tomari, Y. Dicer is dispensable for asymmetric RISC loading in mammals. RNA 18, 24–30 (2012).

Ye, X. et al. Structure of C3PO and mechanism of human RISC activation. Nature Struct. Mol. Biol. 18, 650–657 (2011).

Diederichs, S. & Haber, D. A. Dual role for argonautes in microRNA processing and posttranscriptional regulation of microRNA expression. Cell 131, 1097–1108 (2007).

Leuschner, P. J., Ameres, S. L., Kueng, S. & Martinez, J. Cleavage of the siRNA passenger strand during RISC assembly in human cells. EMBO Rep. 7, 314–320 (2006).

Matranga, C., Tomari, Y., Shin, C., Bartel, D. P. & Zamore, P. D. Passenger-strand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes. Cell 123, 607–620 (2005).

Rand, T. A., Petersen, S., Du, F. & Wang, X. Argonaute2 cleaves the anti-guide strand of siRNA during RISC activation. Cell 123, 621–629 (2005).

Nykanen, A., Haley, B. & Zamore, P. D. ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell 107, 309–321 (2001).

Iwasaki, S. et al. Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes. Mol. Cell 39, 292–299 (2010).

Miyoshi, K., Miyoshi, T., Hartig, J. V., Siomi, H. & Siomi, M. C. Molecular mechanisms that funnel RNA precursors into endogenous small-interfering RNA and microRNA biogenesis pathways in Drosophila. RNA 16, 506–515 (2010).

Han, B. W., Hung, J. H., Weng, Z., Zamore, P. D. & Ameres, S. L. The 3′-to-5′ exoribonuclease Nibbler shapes the 3′ ends of microRNAs bound to Drosophila Argonaute1. Curr. Biol. 21, 1878–1887 (2011).

Liu, N. et al. The exoribonuclease Nibbler controls 3′ end processing of microRNAs in Drosophila. Curr. Biol. 21, 1888–1893 (2011).

Khvorova, A., Reynolds, A. & Jayasena, S. D. Functional siRNAs and miRNAs exhibit strand bias. Cell 115, 209–216 (2003).

Schwarz, D. S. et al. Asymmetry in the assembly of the RNAi enzyme complex. Cell 115, 199–208 (2003).

Hu, H. Y. et al. Sequence features associated with microRNA strand selection in humans and flies. BMC Genomics 10, 413 (2009).

Lau, N. C., Lim, L. P., Weinstein, E. G. & Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294, 858–862 (2001).

Wu, H., Ye, C., Ramirez, D. & Manjunath, N. Alternative processing of primary microRNA transcripts by Drosha generates 5′ end variation of mature microRNA. PLoS ONE 4, e7566 (2009).

Qi, H. H. et al. Prolyl 4-hydroxylation regulates Argonaute 2 stability. Nature 455, 421–424 (2008).

Wu, C. et al. Hypoxia potentiates microRNA-mediated gene silencing through posttranslational modification of Argonaute2. Mol. Cell. Biol. 31, 4760–4774 (2011).

Zeng, Y., Sankala, H., Zhang, X. & Graves, P. R. Phosphorylation of Argonaute 2 at serine-387 facilitates its localization to processing bodies. Biochem. J. 413, 429–436 (2008).

Horman, S. R. et al. Akt-mediated phosphorylation of argonaute 2 downregulates cleavage and upregulates translational repression of microRNA targets. Mol. Cell 50, 356–367 (2013).

Shen, J. et al. EGFR modulates microRNA maturation in response to hypoxia through phosphorylation of AGO2. Nature 497, 383–387 (2013).

Rudel, S. et al. Phosphorylation of human Argonaute proteins affects small RNA binding. Nucleic Acids Res. 39, 2330–2343 (2011).

Mazumder, A., Bose, M., Chakraborty, A., Chakrabarti, S. & Bhattacharyya, S. N. A transient reversal of miRNA-mediated repression controls macrophage activation. EMBO Rep. 14, 1008–1016 (2013).

Leung, A. K. et al. Poly(ADP-ribose) regulates stress responses and microRNA activity in the cytoplasm. Mol. Cell 42, 489–499 (2011).

Seo, G. J. et al. Reciprocal inhibition between intracellular antiviral signaling and the RNAi machinery in mammalian cells. Cell Host Microbe 14, 435–445 (2013).

Rybak, A. et al. The let-7 target gene mouse lin-41 is a stem cell specific E3 ubiquitin ligase for the miRNA pathway protein Ago2. Nature Cell Biol. 11, 1411–1420 (2009).

Johnston, M., Geoffroy, M. C., Sobala, A., Hay, R. & Hutvagner, G. HSP90 protein stabilizes unloaded argonaute complexes and microscopic P-bodies in human cells. Mol. Biol. Cell 21, 1462–1469 (2010).

Smibert, P., Yang, J. S., Azzam, G., Liu, J. L. & Lai, E. C. Homeostatic control of Argonaute stability by microRNA availability. Nature Struct. Mol. Biol. 20, 789–795 (2013).

Bronevetsky, Y. et al. T cell activation induces proteasomal degradation of Argonaute and rapid remodeling of the microRNA repertoire. J. Exp. Med. 210, 417–432 (2013).

Loedige, I., Gaidatzis, D., Sack, R., Meister, G. & Filipowicz, W. The mammalian TRIM-NHL protein TRIM71/LIN-41 is a repressor of mRNA function. Nucleic Acids Res. 41, 518–532 (2013).

Chang, H. M. et al. Trim71 cooperates with microRNAs to repress Cdkn1a expression and promote embryonic stem cell proliferation. Nature Commun. 3, 923 (2012).

Chen, J., Lai, F. & Niswander, L. The ubiquitin ligase mLin41 temporally promotes neural progenitor cell maintenance through FGF signaling. Genes Dev. 26, 803–815 (2012).

Martinez, N. J. & Gregory, R. I. Argonaute2 expression is post-transcriptionally coupled to microRNA abundance. RNA 19, 605–612 (2013).

Ryan, B. M., Robles, A. I. & Harris, C. C. Genetic variation in microRNA networks: the implications for cancer research. Nature Rev. Cancer 10, 389–402 (2010).

Calin, G. A. et al. A microRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N. Engl. J. Med. 353, 1793–1801 (2005).

Tian, T. et al. A functional genetic variant in microRNA-196a2 is associated with increased susceptibility of lung cancer in Chinese. Cancer Epidemiol. Biomarkers Prev. 18, 1183–1187 (2009).

Jazdzewski, K. et al. Polymorphic mature microRNAs from passenger strand of pre-miR-146a contribute to thyroid cancer. Proc. Natl Acad. Sci. USA 106, 1502–1505 (2009).

Jazdzewski, K. et al. Common SNP in pre-miR-146a decreases mature miR expression and predisposes to papillary thyroid carcinoma. Proc. Natl Acad. Sci. USA 105, 7269–7274 (2008).

Ameres, S. L. & Zamore, P. D. Diversifying microRNA sequence and function. Nature Rev. Mol. Cell Biol. 14, 475–488 (2013).

Pasquinelli, A. E. et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 408, 86–89 (2000).

Suh, M. R. et al. Human embryonic stem cells express a unique set of microRNAs. Dev. Biol. 270, 488–498 (2004).

Thomson, J. M. et al. Extensive post-transcriptional regulation of microRNAs and its implications for cancer. Genes Dev. 20, 2202–2207 (2006).

Wulczyn, F. G. et al. Post-transcriptional regulation of the let-7 microRNA during neural cell specification. FASEB J. 21, 415–426 (2007).

Heo, I. et al. Lin28 mediates the terminal uridylation of let-7 precursor microRNA. Mol. Cell 32, 276–284 (2008).

Newman, M. A., Thomson, J. M. & Hammond, S. M. Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing. RNA 14, 1539–1549 (2008).

Rybak, A. et al. A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. Nature Cell Biol. 10, 987–993 (2008).

Viswanathan, S. R., Daley, G. Q. & Gregory, R. I. Selective blockade of microRNA processing by Lin28. Science 320, 97–100 (2008).

Loughlin, F. E. et al. Structural basis of pre-let-7 miRNA recognition by the zinc knuckles of pluripotency factor Lin28. Nature Struct. Mol. Biol. 19, 84–89 (2012).

Nam, Y., Chen, C., Gregory, R. I., Chou, J. J. & Sliz, P. Molecular basis for interaction of let-7 microRNAs with Lin28. Cell 147, 1080–1091 (2011).

Hagan, J. P., Piskounova, E. & Gregory, R. I. Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells. Nature Struct. Mol. Biol. 16, 1021–1025 (2009).

Heo, I. et al. TUT4 in concert with Lin28 suppresses microRNA biogenesis through pre-microRNA uridylation. Cell 138, 696–708 (2009).

Chang, H. M., Triboulet, R., Thornton, J. E. & Gregory, R. I. A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway. Nature 497, 244–248 (2013).

Ustianenko, D. et al. Mammalian DIS3L2 exoribonuclease targets the uridylated precursors of let-7 miRNAs. RNA 19, 1632–1638 (2013).

Heo, I. et al. Mono-uridylation of pre-microRNA as a key step in the biogenesis of group II let-7 microRNAs. Cell 151, 521–532 (2012).

Katoh, T. et al. Selective stabilization of mammalian microRNAs by 3′ adenylation mediated by the cytoplasmic poly(A) polymerase GLD-2. Genes Dev. 23, 433–438 (2009).

Backes, S. et al. Degradation of host microRNAs by poxvirus poly(A) polymerase reveals terminal RNA methylation as a protective antiviral mechanism. Cell Host Microbe 12, 200–210 (2012).

Yang, W. et al. Modulation of microRNA processing and expression through RNA editing by ADAR deaminases. Nature Struct. Mol. Biol. 13, 13–21 (2006).

Kawahara, Y., Zinshteyn, B., Chendrimada, T. P., Shiekhattar, R. & Nishikura, K. RNA editing of the microRNA-151 precursor blocks cleavage by the Dicer–TRBP complex. EMBO Rep. 8, 763–769 (2007).

Xhemalce, B., Robson, S. C. & Kouzarides, T. Human RNA methyltransferase BCDIN3D regulates microRNA processing. Cell 151, 278–288 (2012).

Ruegger, S. & Grosshans, H. MicroRNA turnover: when, how, and why. Trends Biochem. Sci. 37, 436–446 (2012).

Suzuki, H. I. et al. MCPIP1 ribonuclease antagonizes dicer and terminates microRNA biogenesis through precursor microRNA degradation. Mol. Cell 44, 424–436 (2011).

Upton, J. P. et al. IRE1α cleaves select microRNAs during ER stress to derepress translation of proapoptotic caspase-2. Science 338, 818–822 (2012).

Ramachandran, V. & Chen, X. Degradation of microRNAs by a family of exoribonucleases in Arabidopsis. Science 321, 1490–1492 (2008).

Chatterjee, S., Fasler, M., Bussing, I. & Grosshans, H. Target-mediated protection of endogenous microRNAs in C. elegans. Dev. Cell 20, 388–396 (2011).

Chatterjee, S. & Grosshans, H. Active turnover modulates mature microRNA activity in Caenorhabditis elegans. Nature 461, 546–549 (2009).

Krol, J. et al. Characterizing light-regulated retinal microRNAs reveals rapid turnover as a common property of neuronal microRNAs. Cell 141, 618–631 (2010).

Das, S. K. et al. Human polynucleotide phosphorylase selectively and preferentially degrades microRNA-221 in human melanoma cells. Proc. Natl Acad. Sci. USA 107, 11948–11953 (2010).

Thomas, M. F. et al. Eri1 regulates microRNA homeostasis and mouse lymphocyte development and antiviral function. Blood 120, 130–142 (2012).

Libri, V. et al. Murine cytomegalovirus encodes a miR-27 inhibitor disguised as a target. Proc. Natl Acad. Sci. USA 109, 279–284 (2012).

Ameres, S. L. et al. Target RNA-directed trimming and tailing of small silencing RNAs. Science 328, 1534–1539 (2010).

Baccarini, A. et al. Kinetic analysis reveals the fate of a microRNA following target regulation in mammalian cells. Curr. Biol. 21, 369–376 (2011).

Xie, J. et al. Long-term, efficient inhibition of microRNA function in mice using rAAV vectors. Nature Methods 9, 403–409 (2012).

Cazalla, D., Yario, T. & Steitz, J. A. Down-regulation of a host microRNA by a Herpesvirus saimiri noncoding RNA. Science 328, 1563–1566 (2010).

Lee, S. et al. Selective degradation of host MicroRNAs by an intergenic HCMV noncoding RNA accelerates virus production. Cell Host Microbe 13, 678–690 (2013).

Xie, M. & Steitz, J. A. Versatile microRNA biogenesis in animals and their viruses. RNA Biol. http://dx.doi.org/10.4161/rna.28985 (2014).

Berezikov, E., Chung, W. J., Willis, J., Cuppen, E. & Lai, E. C. Mammalian mirtron genes. Mol. Cell 28, 328–336 (2007).

Okamura, K., Hagen, J. W., Duan, H., Tyler, D. M. & Lai, E. C. The mirtron pathway generates microRNA-class regulatory RNAs in Drosophila. Cell 130, 89–100 (2007).

Ruby, J. G., Jan, C. H. & Bartel, D. P. Intronic microRNA precursors that bypass Drosha processing. Nature 448, 83–86 (2007).

Flynt, A. S., Greimann, J. C., Chung, W. J., Lima, C. D. & Lai, E. C. MicroRNA biogenesis via splicing and exosome-mediated trimming in Drosophila. Mol. Cell 38, 900–907 (2010).

Ender, C. et al. A human snoRNA with microRNA-like functions. Mol. Cell 32, 519–528 (2008).

Cazalla, D., Xie, M. & Steitz, J. A. A primate herpesvirus uses the integrator complex to generate viral microRNAs. Mol. Cell 43, 982–992 (2011).

Bogerd, H. P. et al. A mammalian herpesvirus uses noncanonical expression and processing mechanisms to generate viral microRNAs. Mol. Cell 37, 135–142 (2010).

Cifuentes, D. et al. A novel miRNA processing pathway independent of Dicer requires Argonaute2 catalytic activity. Science 328, 1694–1698 (2010).

Yang, J. S. et al. Conserved vertebrate mir-451 provides a platform for Dicer-independent, Ago2-mediated microRNA biogenesis. Proc. Natl Acad. Sci. USA 107, 15163–15168 (2010).

Yoda, M. et al. Poly(A)-specific ribonuclease mediates 3′-end trimming of Argonaute2-cleaved precursor microRNAs. Cell Rep. 5, 715–726 (2013).

Shenoy, A. & Blelloch, R. Genomic analysis suggests that mRNA destabilization by the microprocessor is specialized for the auto-regulation of Dgcr8. PLoS ONE 4, e6971 (2009).

Triboulet, R., Chang, H. M., Lapierre, R. J. & Gregory, R. I. Post-transcriptional control of DGCR8 expression by the Microprocessor. RNA 15, 1005–1011 (2009).

Karginov, F. V. et al. Diverse endonucleolytic cleavage sites in the mammalian transcriptome depend upon microRNAs, Drosha, and additional nucleases. Mol. Cell 38, 781–788 (2010).

Lin, Y. T. & Sullivan, C. S. Expanding the role of Drosha to the regulation of viral gene expression. Proc. Natl Acad. Sci. USA 108, 11229–11234 (2011).

Heras, S. R. et al. The Microprocessor controls the activity of mammalian retrotransposons. Nature Struct. Mol. Biol. 20, 1173–1181 (2013).

Macias, S. et al. DGCR8 HITS-CLIP reveals novel functions for the Microprocessor. Nature Struct. Mol. Biol. 19, 760–766 (2012).

Luhur, A., Chawla, G., Wu, Y. C., Li, J. & Sokol, N. S. Drosha-independent DGCR8/Pasha pathway regulates neuronal morphogenesis. Proc. Natl Acad. Sci. USA 111, 1421–1426 (2014).

Kaneko, H. et al. DICER1 deficit induces Alu RNA toxicity in age-related macular degeneration. Nature 471, 325–330 (2011).

Hu, Q. et al. DICER- and AGO3-dependent generation of retinoic acid-induced DR2 Alu RNAs regulates human stem cell proliferation. Nature Struct. Mol. Biol. 19, 1168–1175 (2012).

Meister, G. Argonaute proteins: functional insights and emerging roles. Nature Rev. Genet. 14, 447–459 (2013).

Karamyshev, A. L. et al. Inefficient SRP interaction with a nascent chain triggers a mRNA quality control pathway. Cell 156, 146–157 (2014).

Ipsaro, J. J., Haase, A. D., Knott, S. R., Joshua-Tor, L. & Hannon, G. J. The structural biochemistry of Zucchini implicates it as a nuclease in piRNA biogenesis. Nature 491, 279–283 (2012).

Nishimasu, H. et al. Structure and function of Zucchini endoribonuclease in piRNA biogenesis. Nature 491, 284–287 (2012).

Siomi, M. C., Sato, K., Pezic, D. & Aravin, A. A. PIWI-interacting small RNAs: the vanguard of genome defence. Nature Rev. Mol. Cell Biol. 12, 246–258 (2011).

Kataoka, N., Fujita, M. & Ohno, M. Functional association of the Microprocessor complex with the spliceosome. Mol. Cell Biol. 29, 3243–3254 (2009).


Circular RNAs: formation and function

As “new kids on the block” in the non-coding RNA family, the circular RNAs (circRNAs) are a large group of uniquely alternatively spliced RNA molecules, which are ubiquitous among eukaryotes and are proving functional in a plethora of contexts. Historically much maligned because of their relatively low abundance and high diversity, it may be surprising that five individuals’ presentations focused predominantly or exclusively on discrete aspects of circRNA biogenesis, recognition and regulation. Some presented on circRNA functions hitherto unheard-of for any ncRNA.

Mariangela Morlando (Universita di Roma, Rome, Italy) showed that, while not widespread, certain circRNAs are not strictly non-coding RNAs at all. An example being circ-ZNF609, these circRNAs retain endogenous internal ribosome entry sites from the cognate mRNA, which enables their translation into protein. She also identified a new circRNA biogenesis factor, FUS, whose pathogenic mutations in amyotrophic lateral sclerosis and autism are linked to altered circRNA formation. Gregory Goodall (Centre for Cancer Biology, Adelaide, Australia) reported on the role of Quaking, an RNA binding protein that regulates circRNA biogenesis in epithelial–mesenchymal transition, a model of cancer metastasis. Nikolaus Rajewsky (Max Delbrück Center for Molecular Medicine, Berlin, Germany) described how CRISPR-Cas9-based genome editing could be used to remove the expression of one brain-specific circRNA, CDR1as. This is a ‘sponge’ for human microRNA-7 (hsamiR-7), which yields mice with a normal phenotype but mildly altered neurological responses.

Simon Conn (Centre for Cancer Biology, Adelaide, Australia) reported another seminal finding by demonstrating that circRNAs are stoichiometrically favoured to bind certain targets in the cell. Specifically, interactions between a circRNA from Arabidopsis and its cognate DNA locus via complementary base-pairing to produce an RNA:DNA hybrid, or R-loop, is sufficient to promote alternative splicing of its cognate mRNA, altering floral morphology. The capacity of circRNAs to bind DNA was supported by Ingrid Grummt, who reported that circRNAs, as well as other ncRNAs and linear RNAs, associate with DNA without complementary base-pairing in DNA–RNA triplexes. Yet, the hyperstability of circRNAs means they are potent mediators in any landscape, particularly in dynamic chromatin.

It has long been recognised that single-stranded RNA viruses, recognised as foreign entities, can drive host immune responses. However, the fact that circRNAs are structurally identical led opening speaker Howard Chang (Stanford University, Stanford, USA) to reason that circRNAs might do the same. As shown by ChiRP–MS (comprehensive identification of RNA binding proteins by mass spectrometry), recognition of self versus non-self circRNAs depends on their biogenesis and marking by endogenous protein co-factors. Importantly, the use of circRNAs seems as effective as current metal ion adjuvants in promoting immune responses to vaccination and to block viral transduction.

Taken together, we have learned much about circRNAs since their systematic identification by NGS in 2013. It is increasingly clear that they are not accidental by-products of splicing. The talks summarized above provide insights into the ways in which circRNAs are involved in neurodevelopment and degeneration, plant development, and cancer. Studies of how circRNA is generated and its functions at the organismal level will surely proceed rapidly in the coming years.


Highly specific detection of microRNA

To demonstrate the specificity of Mir-X miRNA quantitation, we used a series of 8 highly similar synthetic Let7 miRNA variants. We first spiked each of the Let7 miRNAs into separate samples of yeast polyA + RNA and generated cDNA using the Mir-X single-tube reaction. We then tested a panel of variant-specific primers with each cDNA sample to determine each primer&rsquos ability to specifically and individually quantify the Let7 subtypes in the cDNA sample. Despite the high degrees of similarity among the variants and the primers, Mir-X qPCR was highly specific in detecting each Let7 variant.


Methods

Cell culture and transfections

Both Huh7 and HEK293 cells were obtained from the laboratory of Witold Filipowicz. The cells were free of mycoplasma contamination and were cultured in DMEM medium containing 2 mM L -glutamine and 10% heat-inactivated FCS as described earlier 25,31,33 . All cell culture reagents were from Life Technologies. All plasmid transfections were carried out with Lipofectamine 2000 and siRNAs with RNAiMax (Life Technologies) using the manufacturer’s instructions.

In HEK293 cells, 1 μg target mRNA encoding plasmids were transfected in six-well format with 5 pmol pre-miR-122 (Life Technologies) or 500 ng pre-miR-122 encoding plasmid. Four hundred nanograms of synthetic in vitro-transcribed target mRNAs were transfected in a 24-well format, unless described otherwise. Transcription blockage was done with 10 μg ml −1 α-Amanitin (Calbiochem). For experiments using IRE constructs, 50 μM Hemin (Sigma) or 100 μM DFMO (Calbiochem) was added to cell culture media for desired time. For experiments using Tetracycline-inducible constructs, TET-ON HEK293 cells with the inducble expression constructs were cultured in DMEM supplemented with 10% TET-approved FCS (Clontech) and induction of expression of respective gene product was carried out for indicated time durations using 300 ng ml −1 Doxycycline (SIGMA) 47 .

siDICER1 were transfected at 30 nM concentration in a 24-well format and siCAT-1 at 50 nM in the same format. CAT-1 siRNA (5′- CCAGCCUUAUAGCUGUUCU -3′) was purchased from Eurogentec. Dharmacon SMARTpool ON-TARGETplus siRNAs against DICER1 were purchased from Thermo Scientific. All the plasmids used for the study have been listed in Supplementary Table 1.

Huh7 starvation and feeding

For starvation experiments, Huh7 cells grown in normal DMEM were incubated in Hanks’ balanced salt solution (HBSS) supplemented with 10% dialysed FCS for 4 h followed by ‘re-feeding’ cells with HBSS supplemented with 10% normal FCS for an additional 2 h. HBSS supplemented with 10% normal FCS was used for ‘fed’ control.

Luciferase assay

Renilla luciferase (RL) and Firefly luciferase (FF) activities were measured using a Dual-Luciferase Assay Kit (Promega), following the manufacturer’s instructions, on a VICTOR X3 Plate Reader with injectors (Perkin Elmer). The ratio of Firefly luciferase normalized Renilla luciferase expression levels for control is to reporter were used to calculate fold repression.

In the experiment using GFP target reporters, HEK293 cells were transfected in a 24-well format with 250 ng pmiR-122, 100 ng firefly luciferase, 500 ng of GFP-con or GFP-3 × bulge-miR-122 along with 10 ng of luciferase reporter RL-con or RL-3 × bulge-miR-122, or RL-3 × bulge-let-7a (additional control). After 24 h cells were split and at 48 h luciferase activity measured. Firefly normalized RL values were plotted. For GFP-3 × bulge-let-7a reporter, exactly the same transfections were performed with an exception of the GFP-3 × bulge-miR-122 reporter.

RNA isolation and northern blotting

Total RNA was isolated using TRIzol reagent (Life Technologies). Small RNA was isolated using mirVANA miRNA isolation kit (Life Technologies) according to the manufacturer’s instructions. Northern blotting of total cellular RNA (5–10 μg) was performed as described by Pillai et al. 48 . In short, equal amount of total RNA was electrophoresed in 15% Urea–PAGE followed by elecrtrophoretic transfer to nylon membrane. For detection, γ 32 P-labelled 22-nt miRCURY complementary LNA probes for miR-122 and let-7a (Exiqon) or complementary DNA probe for miR-16, U6 snRNA were used. PhosphorImaging of the blots was performed in Cyclone Plus Storage Phosphor System (Perkin Elmer). Uncropped versions of all blots are given in Supplementary Fig. 7.

Real-time PCR

Real-time (reverse transcriptase) PCR for mRNA was done with the Mesa Green qPCR Mastermix Plus for SYBR Assay-Low ROX (Eurogentec) by using the 100–200 ng of the total RNA with the primers listed in Supplementary Table 2. The endogenous control used was 18S ribosomal RNA. For the quantification of miRNA, 30 ng of total RNA was taken. Following primers were used for the amplifications of different miRNAs. For example, human let-7a (assay ID 000377), human miR-122 (assay ID 000445), human miR-122* (assay ID 002130), human miR-16 (assay ID 000391), human miR-21 (assay ID 000397), human miR-24 (assay ID 000402), human miR-125b (assay ID 000449), U6 snRNA (assay ID 001973) and Applied Biosystem Taqman chemistry-based miRNA assay system were used for the experiment. All reactions were done in 7500 Applied Biosystem Real Time System or BIO-RAD CFX96 Real-Time system. Cycles were set as per the manufacturer’s protocol.

Copy number determination

To determine copy number of miR-122, we generated a standard curve using PAGE-purified synthetic miR-122. Five nanograms of total RNA from HEK293 cells (does not contain miR-122) were spiked with 10 6 –10 10 molecules of synthetic miR-122 and analysed by real-time PCR using Taqman miRNA assays (Life Technologies). No Ct was obtained in a control where synthetic miR-122 was not added. The Ct values obtained were plotted to get the standard curve. Ct-values obtained from fed, starved or re-fed samples using 5 and 25 ng of Huh7 RNA were converted to molecule copy number using the standard curve. To calculate copy number of miR-122 per Huh7 cell, we determined total amount of RNA obtained per Huh7 cell under fed, starved and re-fed conditions by again generating a standard curve of total RNA versus number of Huh7 cells. To do that, we counted cells using haemocytometer and isolated RNA by TRIzol reagent and quantified total RNA using NanoDrop. The values obtained were as follows: 34.69 pg (fed 4 h), 21.55 pg (starved 4 h) and 23.19 pg (re-fed 2 h). This value was fairly consistent with Chang et al. 24 who obtained 25 pg of RNA per cell. The copy number obtained by our real-time-based method for non-starved Huh7 (fed) was in that order of 10 4 ( ∼ 1.2 × 10 4 ). This was lower than that obtained by Siegrist et al. 49 , (3 × 10 4 ) using bead array technology.

Similarly, for CAT-1 mRNA standard curve was generated using 100 ng RAW264.7 (mouse cell line) RNA spiked with 10 6 –10 10 molecules of in vitro-transcribed RL-CatA mRNA that contains Renilla-coding region fused to the 3′-UTR (bases 2,169–4,646) of human CAT-1 mRNA. A minus RL-catA control yielded no amplification 3′-UTR-specific primers were used and the same set of primers were used to quantify CAT-1 from 500 ng RNA of Huh7 cells.

Immunoprecipitation

Immunoprecipitation of proteins was done essentially as per published protocols 25,50 . Cells were lysed in a lysis buffer [20 mM Tris-HCl pH 7.4, 200 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol (DTT), 1 × EDTA-free protease inhibitor (Roche), 5 mM Vanadyl ribonucleoside comples (Sigma), 0.5% Triton X-100, 0.5% sodium deoxycholate] at 4 °C for 15 min, followed by clearing the lysate at 3,000 g for 10 min. Protein G agarose beads (Invitrogen) were blocked with 5% BSA in lysis buffer for 1 h and then incubated with required primary antibody for another 3–4 h before the lyaste was added. A final dilution of 1:50 (antibody:lysate) was used for immunoprecipitation. Immunoprecipitation was carried out for 16 h at 4 °C. Post washing with IP buffer (20 mM Tris-HCl pH 7.4, 150 mM KCl, 5 mM MgCl2, 1 mM DTT, 1 × EDTA-free protease inhibitor (Roche)), the beads were divided in two halves: one subjected to RNA isolation with TRIzol LS and another for western blotting.

Immunoblotting

Western blotting of proteins was essentially performed as described previously 48 . For immunoblotting, the cell lysates or immunoprecipitated proteins were subjected to SDS–PAGE, transferred to nitrocellulose membrane and probed with specific antibodies. Antibodies used were as follows: anti-AGO2 (Novus Biologicals Cat# H00027161-M01 1:1,000), anti-DICER (Bethyl Cat# A301-936A 1:5,000), anti-HA (Roche Cat# 11867431001 1:1,000), β-Actin (Sigma Cat# A3854 1:10,000) and phospho-eIF2α (Cell Signaling Technology Cat# 9721 1:500). Imaging of all western blottings was done in UVP BioImager 600 system equipped with VisionWorks Life Science software (UVP) V6.80 and quantification of bands done using the same software. Uncropped versions of all blottings along with molecular-weight marker positions are included in Supplementary Fig. 7.

Polysome isolation

Total polysome isolation was carried out as described 51 . For total polysome isolation, around 6 × 10 6 HEK293 cells were lysed in a buffer containing 10 mM HEPES pH 8.0, 25 mM KCl, 5 mM MgCl2, 1 mM DTT, 5 mM vanadyl ribonucleoside complex, 1% Triton X-100, 1% sodium deoxycholate and 1 × EDTA-free protease inhibitor cocktail (Roche) supplemented with Cycloheximide (100 μg ml −1 Calbiochem). The lysate was cleared at 3,000 g for 10 min followed by another round of pre-clearing at 20,000 g for 10 min at 4 °C. The clarified lysate was loaded on a 30% sucrose cushion and ultracentrifuged at 100,000 g for 1 h at 4 °C. The non-polysomal supernatant was collected from the top. The sucrose cushion was washed with a buffer (10 mM HEPES pH 8.0, 25 mM KCl, 5 mM MgCl2, 1 mM DTT), ultracentrifuged for additional 30 min and the polysomal pellet was finally resuspended in polysome buffer (10 mM HEPES pH 8.0, 25 mM KCl, 5 mM MgCl2, 1 mM DTT, 5 mM vanadyl ribonucleoside complex, 1 × EDTA-free protease inhibitor cocktail) for RNA isolation.

RISC cleavage assay

RISC cleavage assay was essentially performed as described elsewhere with minor modifications 50,51 . HEK293 cells stably expressing FH-AGO2 were transfected with pmiR-122 and target mRNA expression plasmids. For miRISC isolation, cells were lysed, 48 h after transfection, in lysis buffer [10 mM HEPES pH 7.4, 200 mM KCl, 5 mM MgCl2, 1 mM DTT, 1 × EDTA-free protease inhibitor (Roche), 5 mM vanadyl ribonucleoside comples (Sigma), 1% Triton X-100] at 4 °C for 15 min, followed by clearing the lysate at 3,000 g for 10 min. The clarified supernatant was subjected to immunoprecipitation with anti-FLAG M2 affinity gel (Sigma) for 16 h at 4 °C. Beads were washed in IP buffer [20 mM Tris-HCl pH 7.4, 150 mM KCl, 5 mM MgCl2, 1 mM DTT, 1 × EDTA-free protease inhibitor (Roche)] for three times at 4 °C. The affinity-purified miRISC was eluted from the beads using 3 × FLAG Peptide (Sigma) as per the manufacturer’s instructions in a RISC purification buffer (30 mM HEPES pH 7.4, 100 mM KCl, 5 mM MgCl2, 0.5 mM DTT, 3% glycerol).

Affinity-purified miRISC-122 were assayed for target RNA cleavage using a 36 nt RNA 5′- AAAUUCAAACACCAUUGUCACACUCCACCAGAUUAA -3′ bearing the sequence complementary to mature miR-122. Target RNA cleavage assays were carried out in a total volume of 30 μl with 10 fmol of 5’ 32 P-labelled RNA in an assay buffer (100 mM KCl, 5.75 mM MgCl2, 2.5 mM ATP, 0.5 mM GTP) and protein equivalent amounts of RISC at 30 °C for 30 min. RNA isolation was carried out from the reaction mixture, cleaved products were analysed on a 12% denaturing 8 M Urea–PAGE and visualized by autoradiography.

In vitro RISC loading assay

FH-AGO2 affinity purified on agarose beads from FH-AGO2-stable HEK293 cells was incubated with 10 nM synthetic 5′-phosphorylated pre-miR-122 or pre-let-7a, and 500 ng in vitro-transcribed target mRNA in a 20-μl reaction in assay buffer [20 mM Tris-HCl pH 7.5, 200 mM KCl, 2 mM MgCl2, 5% glycerol, 1 mM DTT, 40 U RNase inhibitor (Fermentas)] for 1 h at 37 °C followed by washing of the beads three times with IP buffer. Each reaction was then divided into two halves: one for RNA isolation and the other for western blotting of AGO2.

For assays with recombinant proteins, 50 ng of rAGO2 (Sino Biologicals) was used with 0.1 U of rDICER1 (Recombinant Human Dicer Enzyme kit, Genlantis) keeping the rest of the reaction parameters same as above.

To measure the association of AGO2 and DICER1 along the 3′-UTR, FH-AGO2 stably expressing HEK293 cells was transfected with NHA-DICER1 transiently and FH-AGO2 immunoprecipitated with anti-FLAG agarose beads as described before. FH-AGO2 was eluted from anti-FLAG beads with 3 × FLAG Peptide (Sigma) and isolated miRISC was incubated with RL-3 × bulge-miR-122 at 37 °C with 10 nM pre-miR-122 for 60 min. The reaction was then divided in two halves and immunoprecipitated with anti-AGO2 and anti-DICER1 antibodies for 3 h at 4 °C. Beads were washed and RNA isolated using TRIzolLS followed by quantitative reverse transcriptase–PCR using a single forward and two sets of reverse primers.

For scoring DICER1 processivity, HEK293 cells transiently expressing FH-AGO2 and pre-let-7a were lysed and FH-AGO2 immunoprecipitated as described earlier. FH-AGO2 was eluted from anti-FLAG beads with 3 × FLAG Peptide (Sigma) and isolated miRISC was incubated with RL-con or RL-3 × bulge-let-7a at 37 °C with 10 nM pre-miR-122 for 30 min. RNA was isolated from the reaction and mature miR-122 formed quantified by real-time PCR.

In vitro transcription

In vitro transcription was carried out using mMESSAGE mMACHINE kit (Life Technologies) and poly A tailing of transcripts done with Poly (A) tailing kit (Life Technologies) as per the manufacturer’s protocol. For preparation of plasmid DNA template, RL-con, RL-1 × bulge-miR-122, RL-3 × bulge-miR-122, RL-3 × bulge-miR-122 (W5′), RL-3 × bulge-miR-122 (W3′) and RL-CatA were digested for 4 h at 37 °C with DraI (New England Biolabs) and RL-3 × bulge-let-7a was digested with HpaI (New England Biolabs) the rest of the protocol was as per the manufacturer’s instructions. All transcripts obtained were analysed and size verified by 6% Urea–PAGE and ethidium bromide-based detection.

RNase protection assay

RNase Protection Assay was performed as described earlier 52 . The synthetic miR-122 RNA probe was 5′-end labelled with γ 32 P ATP using T4 Polynucleotide kinase (Ferementas) according to the manufacturer’s protocol. Labelled miR-122 (1.5 pmol 100 fmol radiolabelled and 1.4 pmol 5′-end labelled with cold ATP) was mixed with 500 fmol of target mRNA and precipitated with 0.1 vol sodium acetate (pH 5.2) and 2.5 vol ice-cold ethanol for 1 h at −80 °C. The RNA recovered was dissolved in 30 μl Hybridization Buffer (40 mM PIPES pH 6.8, 1 mM EDTA pH 8.0, 0.4 M NaCl, 80% deionized formamide), denatured at 85 °C for 5 min and then annealed at 35 °C overnight. The mixture was next cooled to room temperature and then RNase digestion was carried out in 300 μl of RNase digestion mixture (300 mM NaCl, 10 mM Tris pH 7.4, 5 mM EDTA pH 7.5, 30 μg RNase A (Fermentas)) at 30 °C 1 h. ProteinaseK treatment was done (10% SDS and 20 mg ml −1 Proteinase K (Roche) at 37 °C for 30 min) followed by RNA extraction with acid phenol:chloroform pH 4.5 in the presence of 20 μg carrier transfer RNA (Sigma). The samples were run in an 18% Urea–PAGE followed by drying the gel and image was obtained using phosphorimager. For partial digestion, the reaction was incubated on ice instead of 30 °C.

Nuclear run-on transcription

Nuclear run-on transcription was performed as described by Roberts et al. 53 . For isolation of intact nucleus from Huh7 cells, ∼ 4 × 10 6 cells were lysed in NP-40 lysis buffer [10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2 and 0.5% (vol/vol) NP-40]. Fractionation verified by western blotting for nuclear and cytosolic markers. The nuclei were resuspended in 30 μl Nuclei Storage Buffer [50 mM Tris-HCl pH 8.3, 0.1 mM EDTA, 5 mM MgCl2, 40% (vol/vol) glycerol] and subjected to run-on transcription in transcription buffer (10 mM Tris-HCl pH 8.3, 2.5 mM MgCl2, 150 mM KCl, 2 mM DTT, 1 mM ATP, 1 mM CTP, 1 mM GTP, 1 mM GTP, 100 U RNase inhibitor) at 30 °C for 30 min. Immediately after the reaction, RNA was isolated using TRIzolLS and subjected to DNaseI (New England Biolabs) treatment at 37 °C for 15 min. DNaseI was inactivated by heating at 75 °C for 5 min. Six hundred nanograms of RNA was used for cDNA preparation in a 10-μl reaction. Minus reverse transcriptase control was done to verify the absence of any genomic DNA contamination.

SLA preparation

SLA was prepared using published protocol 54 . Briefly, for SLA preparation, around 10 10 Leishmania donovani cells were washed thrice with 1 × PBS followed by five to six cycles of liquid nitrogen freeze thawing. The cells were then sonicated in PBS with 0.04% NP-40 for six times. Lysate was cleared at 12,000 g for 10 min at 4 °C and the supernatant collected was SLA. Protein estimation of SLA was done using Bradford method at 595 nm.

The in vitro DICER1 cleavage assay was carried out as mentioned elsewhere 32 . Lysate of HEK293 cells stably expressing FH-AGO2 were prepared as for immunoprecipitation. For each cleavage reaction, 30 μg cell lysate was incubated with 20 μg SLA in assay buffer (10 mM Tris-HCl pH 7.5, 1 mM DTT, 100 mM KCl, 1 × EDTA-free protease inhibitor (Roche)) and 1 mg ml −1 BSA for 30 min at 37 °C. This was followed by immunoprecipitation of the mixture with anti-FLAG M2 agarose beads. Post immunoprecipitation, the beads were subjected to in vitro DICER activity assay.

Statistical analysis

All graphs and statistical analyses were done in GraphPad Prism 5.00 (GraphPad, San Diego, CA, USA). Nonparametric paired t-test were used for analysis and P-values were determined. Error bars indicate mean±s.d.

Data availability

The authors declare that all data supporting the findings of this study are available within the article and its Supplementary Information files or on request.


CONCLUSIONS

The miRvestigator web server provides biologists with a powerful suite of algorithms that together identify miRNAs that bind and regulate genes discovered to be co-expressed in transcriptome profiling studies. The website takes as input a list of gene identifiers (Entrez gene, Ensembl gene, RefSeq transcript or official gene symbol) for one of six different species ( C. elegans , D. melanogaster , G. gallus , H. sapiens , M. musculus or R. norvegicus ). For a given set of genes, miRvestigator: (i) extracts their relevant 3′-UTR sequences (ii) scans these 3′-UTR sequences for an overrepresented motif using the Weeder algorithm (iii) identifies putative binding sites for the overrepresented motif and (iv) applies a HMM and the Viterbi algorithm to identify the miRNA(s) that is most likely to bind to the overrepresented motif. The user friendly web interface makes it easy for biologists to tune parameters and submit jobs to miRvestigator. The output from miRvestigator is a ranked list of miRNAs presented in tabular format with links to corresponding records in miRBase, statistical assessment of complementarity quality, and an alignment of the motif to the miRNA seed sequences. The output also includes a second table with the putative binding locations of the miRNA within the 3′-UTRs of query genes. The miRvestigator provides a valuable tool for users to identify miRNAs regulating biological processes of interest and the information required to design experiments to test these predictions.


Watch the video: What is microRNA miRNA? (September 2022).


Comments:

  1. Taukora

    Also than to understand it

  2. Makya

    Wonderful, this is fun opinion

  3. Macauliffe

    A very useful thing, thank you !!

  4. Leigh

    In any case.

  5. Zolokasa

    Bravo, I think this is a great idea



Write a message