Information

Longevity and extent of transfection after SARS-COV-2 vaccination with Janssen

Longevity and extent of transfection after SARS-COV-2 vaccination with Janssen


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

The Johnson vaccine, unlike the RNA vaccines from Pfizer & Moderna, uses a vector containing DNA encoding for the SARS-COV-2 spike protein. This vector DNA needs to enter the cell, allowing for transcription and translation into viral spike proteins to occur (Fig. 1). These spike proteins are then exposed on the cell surface by the host cells, thereby exposing the antigenic epitopes, creating the immune response.

Basically, this turns the immune cells against their own host, because they are expressing foreign proteins on the cell surface. In effect, I presume, those host cells are subsequently destroyed by the immune system.

Now I was wondering if there has been any research done revealing the consequences of this auto-immune response. In particular how long does it take to get rid of all the transfected cells (or 'vaccinated cells' as they tend to be called) and what is the extent (volume/area affected) of transfected cells? Basically you are genetically altering the host's cells that are subsequently attacked by the immune system. So I am basically interested in the pharmacokinetics of the vaccine I guess.

This safety report from EMA says that in 1 animal (from how many?) there was still genetic material after 180 days to be detected. However, the report says nothing about the extent of transfected cells nor anything about the auto-immune damage after the host attacks its own cells. No references are to be found either; it all seems to be about internal safety studies.

In retrospect I'd rather not have had the Janssen vaccine; I bet mRNA vaccines are a lot more instable, guaranteeing safe removal of the foreign genetic material.

Anyway, I'm drifting… In short, (1) how long does it take to clear all signs of foreign DNA from the host after Janssen, and (2) what is the extent of the cells that are transfected and subsequently attacked and damaged/killed by the host?


Fig. 1. Schematic depiction of the DNA vaccine from Janssen. source: Livingstone et al. (2021)

References
- European medicines agency, Assessment report COVID-19 Vaccine Janssen
- Livingstone et al., JAMA (2021); 325(15): 1575


Both the AstraZeneca (AZ) and Janssen (J) vaccines against SARS-CoV-2 work by using what is known as a viral vector to generate an immune response. In both cases these vaccines use an Adenovirus as the vector (vector in this case means "carrier").

Adenoviruses are a family of double-stranded DNA viruses, most commonly known for being one of the causes of the illness known as the "common cold". There are about 88 human serotypes (how people's bodies react to the virus, different serotypes may not cross-protect by raising an immune response) of the virus divided over the seven species: Adenoviruses A-G. Overall there are about 50 species from a wide range of animals. Because of the diversity and the abundance of the "common cold" most people will have some immune response to at least some of the human adenoviruses.

Adenoviruses are good vectors for vaccines and for other therapeutic uses such as oncolytic viral therapy because the genomes are easily modified and can be made replication incompetent very easily. To do this essential replication genes are removed and the viruses are replicated in cells that provide the essential proteins for the virus to complete its life cycle, so that you get a viral particle that no longer contains the full genome. These viruses are also tolerant of additions to the genome so they can be used to produce proteins that are not normally found in an adenovirus.

On the other hand the adenovirus component of these vectors can cause its own immune response, lowering effectiveness of the immune response to subsequent vaccines developed using the same or a similar sero-type virus.

The AZ vaccine is based on a chimpanzee adenovirus. The J vaccine on the other hand is based off serotype 26 (Ad26) of the human adenoviruses. In both cases the adenovirus is rendered replication incompetent by removal of essential replication genes.

For adenoviruses to work as vaccines they need to invade a cell and then insert their DNA into the nucleus (as seen in the diagram from OP), where cellular mechanisms produce lots of mRNA copies of the gene(s) and concomitantly produce proteins from these mRNA. These proteins are then translocated to the surface of the cell (this is a natural process).

However, in the process the viral DNAs and proteins are recognized by the cell as non self and trigger the innate immune system causing antigen presentation and activation of the adaptive immune system. This whole process is a natural response of the body to infection and does not result in "self recognition", so there is no auto-immune response to the cellular proteins.

Both the AZ vaccine and the J vaccine are administered intra-muscularly, which is very typical for vaccines. Intra-muscular injection is a good site for injection because it can tolerate a big volume and has a relatively high blood flow (both compared to sub-cutaneous (sub-skin)). However, once injected the virus doesn't necessarily stay in the muscle, it can travel in the blood and a portion will end up in other locations, particularly the liver and alveoli of the lung (places where there is a big blood supply and lots of small blood vessels). The adenovirus can infect any cell that expresses the cellular receptor called Coxsackievirus and Adenovirus Receptor (CAR) on its surface, which includes immune cells. There's a fairly comprehensive review of all the mechanisms and cell types here, but it is in written for the scientist. Here's a suitable quote about cell types:

The cell types present when vaccine is administered i.m. include myocytes, skeletal muscle cells, fibroblasts and endothelial cells, with APCs such as DCs or macrophages representing a minority when compared with the abundance of murine skeletal muscle cells

How long the viral genome persists depends on the paper, but not many people have looked. The data I could find seem to indicate that most protein expression is lost after about 3 weeks, but it may persist longer. e.g.:

Although Ag expression could no longer be detected 3 wk after immunization, examination of Ag presentation within the draining lymph nodes demonstrated that APCs were loaded with Ag peptide for at least 40 days postimmunization, suggesting that Ag remains available to the system for a prolonged period, although the exact source of this Ag remains to be determined.

However, the genomes seem to persist for a very long time, perhaps as much as a year or more:

By days 30 and 90, vector sequences remained detectable in most animals in these tissues but gradually declined 102 to 103-fold. After 1 year, relative copy numbers in liver and the injected muscles were comparable with those seen on day 90, whereas a further decline was seen in spleens.

Note that both of the quotes above are not about either the Janssen or AZ vaccines, but about adenovirus vaccines in general, and several Ad vectors were tested in both. It is highly likely that the AZ and J vaccines will have similar data.

Edited to add: I don't know why the DNA persists for so long, but it does not integrate into our genome. It seems that most replication deficient adenoviruses lack the E1A gene, which allows induction of the cell cycle and frees up resources for viral replication. However, the genes involved in viral DNA replication are E2A and E2B, so are not included in the deletion.

TLDR: Viral genome can persist for a very long time, but protein expression does not - possibly because the immune system deals with it quickly after a few weeks (effective vaccination… ). The vectors can reach and infect many tissues in the body, particularly ones with high blood flow and lots of small blood vessels such as lungs and liver.


5 Facts About Johnson & Johnson’s Investigational Janssen COVID-19 Vaccine Candidate

n January 2020, just as SARS-CoV-2, which causes COVID-19, began to spread around the globe, the Janssen Pharmaceutical Companies of Johnson & Johnson started researching potential vaccine candidates.

expand

A close-up view of SARS-CoV-2

Three months later, scientists at the company announced a lead vaccine candidate in development at Janssen and its plans to put it into a Phase 1/2a human clinical trial no later than September 2020—a timeline that, in June, the company announced it would shorten.

In July, data published in Nature showed that Janssen's investigational vaccine elicited an immune response against SARS-CoV-2 in a preclinical, nonhuman study.

Based on the positive data from this preclinical study, which was conducted in collaboration with researchers from Beth Israel Deaconess Medical Center, first-in-human trials of the potential vaccine began in July.*

"We were excited to see these preclinical data because they showed our COVID-19 vaccine candidate generated a strong antibody response and provided protection with a single dose," says Paul Stoffels, M.D. Paul Stoffels, M.D., Vice Chairman of the Executive Committee and Chief Scientific Officer, Johnson & Johnson , Vice Chairman of the Executive Committee and Chief Scientific Officer, Johnson & Johnson. "The findings give us confidence as we progress our vaccine development and upscale manufacturing in parallel."

On September 23, Johnson & Johnson announced it was initiating a multi-country Phase 3 clinical trial to further evaluate the safety and efficacy of Janssen’s COVID-19 vaccine candidate.**

In December 2020, the Phase 3 trial, known as ENSEMBLE, reached full enrollment with roughly 45,000 adult participants.

Johnson & Johnson is deploying the full strength of its science, scale and expertise to help fight the pandemic as COVID-19 continues to affect people and communities across the world—according to the World Health Organization, as of this month, global cases have now surpassed 80 million.

Read on to learn the latest facts about Janssen’s investigational COVID-19 vaccine candidate.


Pfizer, Biontech Covid-19 vaccine uses technology that could revolutionize future immunizations

Last week, Pfizer released preliminary findings that showed its vaccine candidate is more than 90 percent effective at preventing symptomatic Covid-19. On Monday, Moderna added to the encouraging news, with early results from its Phase 3 trial showing that its experimental vaccine is 94.5 percent effective at preventing the illness. Seeing such consistent results at this stage of the trials is a good sign, del Rio said.

“That makes me feel like, ‘gee, Pfizer wasn’t a fluke,’” he said. “This is for real. This is actually working.”

Though reassuring, the results are still preliminary — the full study results have not yet been published in a peer-reviewed journal for other scientists to scrutinize — and it’s not yet known how long the vaccines could offer protection, or whether they will perform well across all age groups and ethnicities.

One of the main differences between the two vaccine candidates is how they are stored. Both require two doses, but Pfizer’s vaccine has to be stored at temperatures of minus 94 degrees Fahrenheit or colder, which has raised practicality concerns about how they could be shipped and disseminated. Moderna’s vaccine does not require ultracold storage and can remain stable at regular refrigeration levels — between roughly 36 to 46 degrees Fahrenheit — for 30 days.

This distinction is probably because of how the vaccines’ synthetic mRNA, or messenger RNA, is packaged, according to Paula Cannon, an associate professor of microbiology at the University of Southern California's Keck School of Medicine. On its own, mRNA is a fragile molecule, which means it has to be coated in a protective, fatty covering to keep it stable.

The refrigeration conditions may have to do with how the mRNA was manufactured and stabilized, Cannon said, though those precise details are proprietary to the companies.

Dr. Drew Weissman, a professor of medicine at the University of Pennsylvania Perelman School of Medicine, has been an early pioneer in mRNA vaccine research and is now collaborating with BioNTech, a German biotechnology company that has partnered with Pfizer. He said work is ongoing to enhance the experimental vaccine — including improvements to its storage requirements.

“There are definitely improvements that are already being developed,” he said.

Both the Pfizer vaccine and the Moderna vaccine are made using synthetic messenger RNA. Unlike DNA, which carries genetic information for every cell in the human body, messenger RNA directs the body’s protein production in a much more focused way.

“When one particular gene needs to do its work, it makes a copy of itself, which is called messenger RNA,” Cannon said. “If DNA is the big instruction manual for the cell, then messenger RNA is like when you photocopy just one page that you need and take that into your workshop.”

The Pfizer vaccine and the Moderna vaccine use synthetic mRNA that contains information about the coronavirus’s signature spike protein. The vaccines essentially work by sneaking in instructions that direct the body to produce a small amount of the spike protein. Once the immune system detects this protein, the body subsequently begins producing protective antibodies.

“Those antibodies will work not just against the little bit of spike protein that was made following vaccination, but will also recognize and stop the coronavirus from getting into our cells if we’re exposed in the future,” Cannon said. “It’s really a clever trick.”

But as elegant a mechanism as this is in theory, mRNA vaccines have faced real biological challenges since they were first developed in the 1990s. In early animal studies, for instance, the vaccines caused worrisome inflammation.

“That became one of the big questions: How do you get this inside the body without creating an inflammatory response?” said Norman Baylor, president and CEO of Biologics Consulting and the former director of the FDA’s Office of Vaccines Research and Review.

Though neither company has reported any serious safety concerns so far, scientists will continue to monitor participants in both trials over time.

“There’s always a concern when you are trying to trick the immune system — which is what a vaccine does — that you could have unintended side effects,” Cannon said. “The immune system is incredibly complicated and it’s different from person to person.”


Can technology help us win the vaccine race against COVID-19?

The unprecedented determination and speed with which COVID-19 vaccines were developed and approved has been impressive to say the least. However, the success has brought some concern about the abnormally fast vaccine development procedure. Can vaccines developed so fast be safe?

This was a question often raised in public. It took much effort from the scientific community to convince the doubters that no corners had been cut and no safety measurements neglected, and the accelerated vaccine development was down to excellent co-operations between academic institutions, pharmaceutical and biotech companies, and governmental organizations. Technology also played a key role and although the RNA-based vaccine approach has been presented as a novel technology everywhere, it has been around since 1989 [1], but its promise was only fulfilled by recent breakthroughs in RNA engineering and delivery.

Our panelists will discuss vaccine development, addressing unknowns in immune response and leveraging the immune system in disease treatment.

The public opinion has painted the picture of recklessness, but in fact the only risk taken during the vaccine development process relates to the vaccine production, which started before results were available from clinical evaluation and drug approval was received. Generally, production starts only after the vaccine candidate has been approved by authorities such as the FDA or the EMA . However, in this case production started while vaccine candidates were evaluated in phase III clinical trials , which provided a head start for vaccine distribution and administration once authorization was obtained. This was obviously a big risk as there was no guarantee that the vaccine was efficacious while already in production. Fortunately, the clinical studies generated favorable results and both RNA- and adenovirus-based vaccines have been approved in many countries. Mass vaccinations around the world have further confirmed that the COVID-19 vaccines were safe, and much hope was placed on their efficacy allowing life to return to normal as we knew it before the pandemic.

Then , the alarming news about novel SARS-CoV-2 variants arrived , which were thought to show higher transmission rates and enhanced pathogenicity [2]. Already exhausted by the effects of the pandemic for more than a year, with more than 122 million infected individuals and 2.7 million deaths worldwide and a global economy severely damaged , people started to ask whether there is any way out of this – c an science and technology come to our aid? Can technology help us win the race against COVID-19?

Science and technology have played crucial roles at all levels of translational medicine related to the COVID-19 pandemic. Scientific discoveries and technology development have facilitated diagnostics of the pandemic including rapid PCR technologies, antibody tests, and next-generation sequencing (N G S) methods to understand the origin of SARS-CoV-2 [3, 4]. The vaccine development has strongly relied on technology, from the initial sequence data on the SARS-CoV-2 genome and bioinformatics, computational approaches and structural modelling to identify appropriate antigen targets. Methods related to antigen production in the form of recombinant proteins, peptides, viral vectors or nucleic acids represent key assets for success. Vaccine delivery comprises an area of enormous importance and although most vaccine candidates have been administered intramuscularly, major technology development has been dedicated to delivery optimization in the form of novel innovative devices and also to finding alternative routes such as intranasal delivery through application of spray formulations.

Another aspect of vaccine administration, especially for nucleic acid-based vaccines , relates to the application of nanoparticles to improve and target delivery, but also particularly in the case of RNA to provide protection against degradation and prevent loss of antigen production in host cells. Taking advantage of innovative technologies, both adenovirus-based and RNA-based COVID-19 vaccines have demonstrated over 90% efficacy in large clinical trials [5]. However, there are still unanswered questions and clear areas of potential improvements:

  • How efficacious are the vaccines in the elderly and especially in children?
  • How long is the duration of protective immunity from vaccines?
  • Do factors such as race, gender, genetics, pre-existing conditions, and other factors affect vaccine efficacy?
  • Is the prime-boost vaccination strategy necessary or is a single vaccination sufficient for efficacy?
  • Can vaccine candidates be mixed and matched to provide synergistic effects?
  • How can the stability, especially for RNA-based vaccines , be improved to facilitate storage and transportation of vaccines?
  • How should we deal with existing and emerging SARS-CoV-2 mutations and variants ?
  • How can we prepare for potential emerging pandemics?

To find out the efficacy of vaccines in the elderly and children , clinical trials in the relevant age groups will directly provide the answer . For instance, the ChAdOx1 nC oV -19 vaccine based on a chimpanzee adenovirus has been subjected to a phase III clinical trial in older individuals [6]. Moreover, as mass vaccinations have targeted the elderly and healthcare workers in the first phase, information on vaccine efficacy will be available soon. Clinical studies have also been planned for children as young as 6 years of age.

The duration of the protective immunity of existing vaccines will be determined from the analysis of global mass vaccinations. As more than 3 45 million doses have been administered and 101 million people have been fully vaccinated worldwide (as of March 21, 2021), there will be plenty of data for epidemiologists to digest with time. Obviously, data from clinical trials that started in 2020 will provide additional information. T he effect of r ace , gender, genetics, pre-existing conditions, and other factors will also be subjected to scientific evaluation applying various tools in bioinformatics, genomics, proteomics, medicine and epidemiology in large population s of vaccinated individuals .

The points addressed above involve straight – forward data analysis and rely to a large extent on existing technologies . However, the rest of the issues can additionally profit from novel innovations. For instance, the question of prime-boost regimens, where two vaccinations take place at two or several weeks intervals have been replaced by a single immunization with an adenovirus-based vaccine candidate ( NCT04526990 ) . In addition to applying this adenovirus-vector approach, further development of more stable RNA-based vaccines and the use of self-amplifying RNA virus vectors might provide the technology to allow proficient immune responses after a single vaccine administration. The approach of mixing and matching COVID-19 vaccine candidates is already in full swing [5]. For instance, there are plans to evaluate the combination of the ChAdOx1 nCoV-19 vaccine and the Russian Sputnik V vaccine based on adenovirus Ad26/Ad5 vectors in a clinical setting. Similarly, a prime-boost regimen for ChAdOx1 nCoV-19 and the lipid nanoparticle (LNP)-mRNA vaccine BNT162b 2 is planned for evaluation in humans [7]. Furthermore, data from a heterologous vaccination strategy in mice consisting of a self-amplifying RNA vector-based vaccine and ChAdOx1 nCoV-19 dominantly elicited cytotoxic T cell and Th1 + T cell responses superior to each homologous vaccination alone [8].

The stability and delivery of RNA are issues to address, which could improve both vaccine efficacy and relax the storage and transport requirements. Technology development can play a crucial part on two levels. First, RNA stability can be improved by engineering of various RNA sequences. Modifications made to the 5’ and 3’ end untranslated regions of the mRNA and the poly(A) tail have enhanced both RNA stability and translation efficacy. Moreover, codon optimization and incorporation of pseudouridine analogs have provided a positive effect on mRNA stability and translation , resulting in enhanced immune responses . Encapsulation of target mRNA in LNPs has facilitated cellular delivery and protected against premature RNA degradation. Although these technologies have been applied for the existing RNA-based COVID-19 vaccines, further engineering efforts should be considered.

The problems encountered with the need for low (-20°C) to ultra-low (-80°C) storage and transport conditions for RNA-based vaccines have triggered the search for methods to improve vaccine stability and allow storage at more user-friendly temperatures. In this context, although addition of ethanol could restore aggregation and loss of efficacy of LNPs subjected to freeze — thaw cycles, the approach was impractical as LNP solutions had to be dialyzed prior to use [9]. However, addition of trehalose or sucrose to LNP solutions prior to lyophilization allowed storage at room temperature and reconstitution in an aqueous buffer without affecting the delivery potency. This could present a solution for novel LNP-mRNA vaccine candidates.

In the context of the SARS-CoV-2 variants , meaningful information can be acquired on already existing and emerging mutants by N G S and computational biology in the form of sequencing data and in silico models to evaluate the efficacy of existing vaccines, respectively [2]. Structure-based approaches can provide useful information for the design of novel vaccines targeting existing and emerging mutants, which have been predicted or shown to reduce the efficacy of existing vaccines. Nucleic acid-based vaccines can be quickly subjected to modifications of more efficient tailor-made versions to specifically target SARS-CoV-2 variants [10]. Modern technologies should also focus on the design of pan-coronavirus vaccine s , which can provide a broader range of protection against current and future variants and to be better prepared for potential emerging outbreaks and prevent them from reaching pandemic levels . Although other factors related to better control of animal care, prevention of illegal animal trade, rethinking of travel policies and better hygiene are important in the fight against pandemics, appropriate and efficient development and application of innovative technologies will certainly contribute to being able to overcome the COVID-19 pandemic.


VAST AMOUNTS OF SAFTEY DATA COMPARED TO NORMAL PHASE 3 TRIALS

Not only that though we have massive amounts of data. Trials with tens of thousands of vaccinations. Also, unusually, we have many vaccine candidates all for thh same disease and with only slight differences.

There are nearly 50 vaccines in clincal trial and 11 in phase 3, one already completed the primary end point for phase 3 as of writing this,

Of the 11 in phase 3, 7 specifically present the spike to our bodies in various ways, and four are inactivated viruses

The vaccines in phase 3 that present the spike as mRNA are:

Then Novavax presents the spike itself as a nanoparticle, and then the ones that attach it to an adenovirus are

Then there are three inactivated viruses from China and one from India.

That&rsquos very promising. For details see my

In that video I explain that the spike by itself is just a protein, and has no RNA in it so can&rsquot replicate. This is the image of the spike:

I also explain in the video that the mRNA can&rsquot replicate either. Messenger RNA is produced by the DNA but can&rsquot replicate by itself in a normal mammalian cell. Cells can replicate DNA but not RNA.

So RNA viruses have to create their own replication machine. This diagram explains in broad terms how the SARS-CoV2 virus hijacks the cell to replicate itself.

I have no idea what it all means either I just want you to get an idea of how complex it is. If you are a biologist and want to check out the details it&rsquos here.


No evidence yet for antibody-dependent enhancement in COVID-19

Dengue remains the best-studied and one of the very few solid examples of ADE. It’s thought to occur in communities where there are multiple viral strains of dengue circulating. While antibodies against one dengue strain will typically reliably protect against that strain, things can go awry when the antibodies encounter a different strain of dengue. Instead of neutralizing the virus—that is, binding to and blocking a protein the pathogen needs to enter host cells—the antibodies only bind to the virus without neutralizing it.

That can become a problem when immune cells, such as macrophages, dock onto the tail ends of antibodies using specialized receptors known as Fc receptors—which they often do to clear up antibody-virus debris. Because dengue viruses can use Fc receptors to infect cells, if the antibodies aren’t disabling the pathogen, they actually end up helping the virus enter macrophages to infect the cells, Trojan horse–style, explains Dennis Burton, a microbiologist at the Scripps Research Institute in California. This amplifies viral replication, potentially pushing the immune system into over-drive and paving the way for severe disease. “That’s the hallmark of ADE, basically . . . you make infection easier, you infect more cells, you get worse disease.”

But there are still many questions surrounding ADE and its mechanism. It’s not entirely clear, for instance, if the antibodies are the sole effectors of ADE, or if other parts of the immune system also play a role. Nor is it certain whether it’s strictly the non-neutralizing characteristic of the antibodies that matters most—it could also be that neutralizing antibodies could also allow viruses to infect macrophages if they’re not numerous enough to block all key proteins across a virus’s surface.

“It might be that any antibody would enhance if you’ve got it at a dose that doesn’t work,” notes James Crowe, an immunologist at Vanderbilt University Medical Center. “This is very hard to study in humans.”

Solid evidence for ADE in natural viral infections exists only in dengue virus and some of its relatives. There are a handful of other viruses where ADE has been demonstrated in vitro—in experiments that mix macrophages or similar cells with antibodies and virus and see whether the virus is capable of infecting the cells in spite of the presence of antibodies, Crowe explains. Such experiments have found hints of ADE with viruses including Ebola virus, HIV, and coronaviruses such as SARS and MERS. However, it’s still a mystery to what extent this occurs in live organisms in the presence of a functioning immune system. “The immune system typically modulates things to your benefit. I’m not saying that ADE does not occur in the body—I’m just saying it’s difficult to bridge the results in the test tube to what happens in the body,” Crowe says.

It’s not yet clear if SARS-CoV-2 is capable of infecting macrophages. Although some scientists have reportedly spotted viral protein inside macrophages, whether it actually infects and replicates in macrophages in the body “is something investigators are trying to determine right now,” Crowe says.

Barney Graham, the deputy director of the National Institute of Allergy and Infectious Diseases’s Vaccine Research Center, which is collaborating with the company Moderna on a coronavirus vaccine, told PNAS last month that he doubts the dengue mechanism of ADE would apply to SARS-CoV-2 because the coronavirus primarily targets ACE2, not Fc, receptors, and has a very different pathogenesis compared to the dengue family. And even for the original SARS that caused an outbreak in 2003, in vitro experiments suggest that it could infect a human cell line using an Fc receptor, but the virus did not reproduce into infectious particles, Graham writes in a perspective article in Science.

It’s theoretically possible that infections caused by other coronaviruses could generate antibodies in people’s blood and cause ADE upon infection with SARS-CoV-2, but there’s little evidence for this so far, Crowe notes. And in principle, some COVID-19 patients could develop antibodies that don’t neutralize, or produce neutralizing ones at insufficient concentrations, and then develop severe symptoms once they’re infected a second time. But a handful of reported SARS-CoV-2 re-infections have been found to be due to flawed tests. And two preprints appeared last week suggesting that in US patients who received antibody-containing blood plasma transfusions from COVID-19 survivors, the treatment did not make the disease worse, supporting the argument against ADE.


Materials and Methods

Cell culture and reagents

All studies were performed in accordance with approved IRB protocols by the University of California (UCSD), San Diego. Human lung epithelia cell line Calu-3, human colon epithelia cell line Caco-2 were obtained from ATCC. Calu-3 was maintained in MEM medium supplemented with 1× NEAA, penicillin-streptomycin (100 IU/ml), and 10% FBS. Caco-2 was cultured in MEM medium with 1× NEAA, penicillin-streptomycin (100 IU/ml) and 20% FBS. 293FT and Vero E6 cells were maintained in DMEM medium with 10% FBS. Spike antibody recognizing S2 subunit of SARS-CoV and SARS-CoV-2 was purchased from Nouvs (NB100-56578). Anti-VSV M antibody was from EMD Millipore (MABF2347). EK1 peptides were obtained from Phoenix Pharma. Luciferase assay kit was purchased from Promega. 7α-HC, 25HC, water-soluble cholesterol, and Sandoz 58-035 were obtained from Sigma. Camostat, nafamostat and E-64d were purchased from Selleck Chemicals.

VSV pseudovirus rescue, amplification and titration

Pseudo typed VSV was generated based on previously described work (Whitt, 2010 ). In brief, BHK-21/WI-2 cells were infected with vTF7-3 expressing T7 polymerase for 45 min and then transfected with pVSV-EGFP-dG (addgene 31842) or pVSV-FLuc-dG, along with pBS vectors expressing VSV-N, VSV-P, VSV-L, and VSV-G (Kerafast) at ratio 3:3:5:1:8, using Opti-MEM and Lipofectamine 3000 according to the manufacturers’ instructions. 48 h post-transfection, culture supernatants were collected and filtered through 0.22 μm filters to remove residual vaccinia virus. 293FT cells transfected with pMD2.G (addgene 12259) encoding VSV-G for 24 h were inoculated with the filtrate to amplify the VSV pseudovirus. 24 h post-inoculation, supernatants were collected and either stored at −80°C. Titration of EGFP-expressing pseudovirus was performed by inoculating Vero E6 cells seeded in 96-well plates with 10-fold serial dilutions of the virus stock. 24 h post-inoculation, numbers of GFP-positive cells were counted and used to calculate virus titer as infectious unit per milliliter (IU/ml). Titration of FLuc-expressing pseudoviruses was performed by inoculating Vero E6 cells transfected with VSV-G in 24-well plates with 10-fold serial dilutions of the virus stock. 1 h post-inoculation, new medium containing 1.5% methylcellulose was used to replace the inoculum. 2 days post-inoculation, cells were washed and stained with crystal violet. Plaque numbers were counted and used to calculate virus titer.

SARS-CoV-2, SARS-CoV, and MERS-CoV pseudovirus production, titration, and characterization

293FT cells were transfected with pLVX expressing SARS-CoV-2-S, SARS-CoV-S, or MERS-CoV-S. Nineteen amino acids at the C terminus of SARS-CoV-2-S and SARS-CoV-S was deleted, given previous report that the shortened mutant has improved incorporation into the pseudovirus envelope (Fukushi et al, 2005 Hoffmann et al, 2020a ). At 24 h post-transfection, cells were infected with VSV pseudovirus containing Fluc or EGFP. Cells were washed four times with medium 1 h post-inoculation and maintained in medium for 24 h. Then supernatant containing pseudovirus was collected, centrifuged, and used or stored at −80°C. The titer was measured using the same method for VSV pseudovirus mentioned above. To characterize the pseudovirus, 1 ml supernatant was concentrated by ultra-centrifugation at 106,750 × g for 2 h at 4°C. Then, 40 μl lysate buffer with SDS was added and heated for 5 min at 95°C. The samples were subjected to SDS–PAGE and immunoblotting using spike antibody and VSV matrix antibody.

SARS-CoV-2, SARS-CoV, and MERS-CoV pseudovirus infection and inhibitors treatment

Cells were pretreated with 25HC for 16 h and then infected with SARS-CoV-2, SARS-CoV, and MERS-CoV pseudovirus in fresh medium without 25HC. After 2-h infection, virus was removed and fresh medium without 25HC was added. For pseudovirus with Fluc, cells were lysed at 24 h post-infection and subjected for luciferase activity assay according to manufacturer's instruction. For pseudovirus with EGFP, infected was evaluated by taking picture for at least 5 random fields at 24 h post-infection.

Cell–cell fusion assay

293FT or Vero E6 cells were treated with EtOH or 25HC overnight, and then co-transfected with pEGFP-C1 and a pLVX vector expressing one of SARS-CoV-2-S, SARS-CoV-S, and MERS-CoV-S using Lipofectamine 3000, in the absence of EtOH or 25HC. 4 h post-transfection, fresh medium containing EtOH and 5 μM 25HC was supplemented. For 293FT cells, 24 h post-transfection, cells were stained with Hoechst for 10 min at 37°C and examined under Leica fluorescence microscope (DMI 3000). For Vero E6 cell, 48 h post-transfection, cells were washed twice with PBS, and incubated with 2 μg/ml Trypsin in PBS for 20 min. Trypsin-containing PBS was subsequently removed, and cells were further incubated in medium for 40 min, prior to a 10-min Hoechst staining at 37°C and examination under a fluorescence microscope. For quantification of membrane fusion, the percentage of nuclei involved in syncytia formation in each group was calculated by averaging three corresponding fields, and the extent of membrane fusion for each group was calculated by averaging 3 independent biological replicates for that group.

Pseudovirus binding assay

Calu-3 cells were treated with EtOH or indicated concentrations of 25HC for 16 h, prior to incubation with SARS-CoV-2 pseudovirus at MOI = 2 at 4°C. Cells were then washed with chilled PBS three times and lysed with TRIzol. The RNA was extracted using a Direct-zol RNA Kit (Zymo). The amount of bound virions was measured by RT–qPCR using primers for VSV-L. The primers are as follows: GAPDH (Forward: GGCCTCCAAGGAGTAAGACC Reverse: AGGGGTCTACATGGCAACTG), VSV-L (Forward: GACGGGCTCATCAGTCTATTT Reverse: GGATACCTCACTCCTCACAATC).

ALOD4 protein purification, labeling, and incubation

ALOD4 protein was expressed, purified, and labeled based on a previously described protocol (Endapally et al, 2019 ). Briefly, the plasmid pALOD4 (Addgene 111026) was transformed into BL21(DE3)pLysS competent cells (Invitrogen) (Gay et al, 2015 ). ALOD4-His6 was purified using Capturem His-tagged purification kit (Takara). The purified protein was further concentrated by 10 kD Amicon Ultra centrifugal filters. For ALOD4 labeling by Alexa Fluor 488 C5 (AF488) (Invitrogen), ALOD4 was mixed with AF488 at 4°C for 16 h. The reaction was quenched by 10 mM DTT. Excess dye was removed by desalting.

For ALOD4 binding assay, 3 μM purified or labeled ALOD4 was added to each well, and ethanol- or 25HC-treated cells were incubated with ALOD4 for 30 min at 37°C. Cells were washed twice with PBS prior to WB sample preparation. For ALOD4 binding assay with cholesterol rescue, ethanol- and 25HC-treated cells were treated with cholesterol for 1 h at 37°C prior to incubation with ALOD4. For ALOD4 binding assay with SZ58-035, vehicle or SZ58-035 was present during the treatment with 25HC and incubation with ALOD4.

Cholesterol and Sandoz 58-035 rescue assays

Calu-3 cells were pretreated with Ethanol or 5 μM 25HC for 16 h. For cholesterol rescue experiment, the cells were washed and incubated with PBS or 80 μM water-soluble cholesterol for 1 h. Fresh medium and SARS-CoV-2 pseudovirus without compounds were added to incubate with the cells for 2 h. Then, cells were washed and cultured in fresh medium. For Sandoz 58-035 rescue experiment, after overnight treatment of 25HC in the presence of DMSO or 40 μM SZ58-035, Calu-3 cells were washed and incubated with DMSO or 40 μM SZ58-035 for 1 h prior to infection with SARS-CoV-2 pseudovirus. For pseudovirus with Fluc, the cells were lysed and subjected to luciferase activity measurement at 24 h post-infection. For EGFP pseudovirus, EGFP signals were captured by fluorescence microscope at 24 h post-infection.

ACAT knockdown rescue assays

Calu-3 cells were transduced with lentivirus expressing shACAT1/2 for 48 h. Then, cells were treated with medium containing EtOH or 5 μM 25HC overnight. Calu-3 cells were washed prior to infection with SARS-CoV-2 pseudovirus. The cells were lysed and subjected to luciferase activity measurement at 24 h post-infection.

SARS-CoV-2 isolate USA-WA1/2020 infection

SARS-CoV-2 isolate USA-WA1/2020 was obtained from BEI Resources. SARS-CoV-2 was propagated and infectious units quantified by plaque assay using Vero E6 cells. Calu-3 cells were pretreated with 25HC overnight and then infected with SARS-CoV-2 at MOI = 0.1 for 1 h at 37°C. Then, cells were washed and fresh medium with 25HC was supplemented. 48 h post-infection, supernatant and infected cells were lysed using TRIzol and RNA was extracted using a Direct-zol RNA Kit (Zymo) and quantified by RT–qPCR using SARS-CoV-2 N primers. The primers are as follows: SARS-CoV-2-N (Forward: CACATTGGCACCCGCAATC Reverse: GAGGAACGAGAAGAGGCTTG). Viral titer in supernatant was quantified by plaque assay in Vero cells.

Lipid droplet staining

Calu-3 cells were suspended in MEM medium with 2% lipid depleted serum and seeded in the wells of a Lab-TEK II 4-well chamber or a 96-well plate. For the treatment with 25HC, cells were treated with 5 μM 25HC for 16 h. Then, the cells were washed and stained with 1× LipidSpot 488 (Biotium) for 30 min. The signals were captured by fluorescence microscope. For the infection with live SARS-CoV-2 virus, Calu-3 cells were infected with SARS-CoV-2 USA-WA1/2020 at MOI = 2 for 1 h at 37°C. Then, cells were washed, and fresh medium was supplemented. Cells were stained with 1× LipidSpot 488 for 30 min after 24 h post-infection. The fluorescence signal was captured by Incucyte S3.

Lung Organoid 25HC treatment and infection

Human iPSC derived lung organoids were generated using previously published methods (Leibel et al, 2019 Miller et al, 2019 ) and characterized by expression of ACE2, TMPRSS2 and alveolar cell epithelial markers (SFTPC, SFTPB, HOPX) (Tiwari et al, Manuscript under preparation). These 60D differentiated lung organoids were pretreated overnight with 25HC (5 μM) and were infected with luciferase-expressing SARS-CoV-2 pseudovirus (100 μl). At 2 h post-infection, organoids were incubated with fresh medium containing 25HC. After 24 h, luciferase activity was measured to quantify viral infection.

Lentivirus production and transduction

Two sgRNA oligos targeting ACE2 were cloned into lentiCRISPR v2 (addgene 52961) and two shRNA oligos targeting ACAT1 and ACAT2 were cloned into pLKO.1 (addgene 8453). CH25H was cloned into pLVX vectors. The target sequences of sgRNA and shRNA are as follows: ACE2-sgRNA1: CAGGATCCTTATGTGCACAA ACE2-sgRNA2: CCAAAGGCGAGAGATAGTTG ACAT1-shRNA: GCCACTAAGCTTGGTTCCATT ACAT2-shRNA: GCTCTTATGAAGAAGTCAGAA. The cloning primers for CH25H (Forward: GGATCTATTTCCGGTGAATTCATGAGCTGCCACAACTGCTCC Reverse: GCGGTCATACGTAGGATCCTTACCGCGCTGGGACAGATG). 293FT cells seeded in 6-well plates were co-transfected with pMD2.G (0.6 μg), psPAX.2 (1.2 μg), and sgRNA, pLVX, or pLKO.1 vector (1.8 μg) using Opti-MEM and Lipofectamine 3000 according to the manufacturers’ instruction. At 4 h post-transfection, supernatant was replaced with fresh medium. At 48 h post-transfection, supernatant was harvested and used to transduce Calu-3 cells. After 12 h transduction, lentivirus was removed and replaced with fresh medium.

Cell viability assay

Calu-3 or Caco-2 cells were treated with EtOH or twofold serial dilutions of 25HC for 48 h. Cells were then examined for ATP levels using CellTiter-Glo (Promega) according to the manufacturer's instruction.

Western blot and antibodies

Cell lysates were subject to SDS–PAGE on 4–20% Bis-Tris gels and transferred to PVDF membranes. Pierce Fast Western Blot Kit (Thermo Scientific) was used to perform immunoblot according to the manufacturer's instructions with the following antibodies: mouse anti-His-tagged (Millipore 05-949) and HRP-conjugated mouse anti-tubulin (Proteintech HRP-66031). Chemiluminescence of anti-His-tagged antibody was performed with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific).

RNA-seq analysis from SARS-CoV-2-infected cells and COVID-19-infected patients

For the RNA-seq data from SARS-CoV-2, IAV, HPIV3, and RSV infection (Blanco-Melo et al, 2020 ), target gene expression in infected cells relative to uninfected controls were calculated and log2(fold change) was displayed as a heatmap. For single-cell RNA sequencing analysis from COVID-19-infected patients, scRNA-seq dataset for bronchoalveolar lavage fluid from four healthy controls, three moderate COVID-19-infected patients, and six severe COVID-19-infected patients were downloaded from GEO under the accession number GSE145926 (Liao et al, 2020 ). Analysis was based on the read count matrix, with cell type information provided by meta annotation text file. Reads counts of each gene were collected and calculated using the HDF5 matrix file provided. The read count box plot for HD, moderate, and severe COVID-19-infected patients are drawn based on this analysis.

Statistical analysis

All data and graphs were analyzed and plotted using Prism 8.0.2 (GraphPad Inc.). Statistical analysis was performed using Student's t-test (paired, two-sided) if not specially stated in the figure legends. Data are presented as the means ± standard deviation (SD).


Hazards of the COVID-19 vaccine

https://commons.wikimedia.org/wiki/File:Sputnik_V_Vaccine_Representation.jpg

By ROMEO F. QUIJANO, M.D.
Professor (Ret.)
Department of Pharmacology and Toxicology
College of Medicine, University of the Philippines Manila

The COVID-19 (SARS-Cov-2) vaccine is fraught with hazards. This should be the obvious, rational conclusion of anyone who cares to objectively study the available scientific and other relevant information about it. There are many factual danger signals that are easily discernible.

During the 2002-2003 SARS-1 outbreak, it took about 20 months before a vaccine was made ready for human testing in clinical trials despite the fact that concerns about safety were still unresolved. This was already way too fast compared to the usual time necessary for pre-clinical trials or animal studies to be satisfactorily completed before any ethical experimentation on human beings or clinical trials can be started. Yet for Covid-19 candidate vaccines, clinical trials were started barely five months after SARS-Cov-2 emerged, bypassing the necessary pre-clinical studies normally required and ignoring the serious safety concerns in the previous attempt to rush a SARS-1 vaccine (which was eventually scrapped).

One major safety concern in developing a vaccine is how to get around the danger that the vaccine might actually “enhance” the pathogenicity of the virus, or make it more aggressive possibly due to antibody-dependent enhancement (ADE), as what happened with previous studies on test vaccines in animals. If that should happen in a major human trial the outcome could be disastrous. (1,2,3,4) This serious adverse effect may not even be detected by a clinical trial especially in highly biased clinical trials laden with conflicts of interest involving vaccine companies. Even when a serious adverse event is detected, this is usually swept under the rug.

For example, initial clinical trial results for the COVID-19 vaccine of Moderna reportedly showed that three of the 15 human experimental subjects in the high dose group suffered serious and medically significant symptoms. Moderna, however, concluded that the vaccine was “generally safe and well tolerated,” which the corporate-dominated media dutifully reported, covering-up the real danger from the vaccine.(5,6,7,8) In a brazen act of unethical behaviour, Moderna even used a volunteer vaccine recipient, Ian Haydon, to appear in many appearances on media promoting Moderna’s experimental COVID-19 vaccine. Moderna encouraged Haydon to appear on TV to deceive the public and its shareholders. Less than 12 hours after vaccination, Haydon suffered muscle aches, vomiting, spiked a 103.2 degree fever and had lost consciousness.(9) The vaccine, pushed by Dr. Anthony Fauci, director of the US National Institute of Allergy and Infectious Diseases, and financed by Bill Gates, used an experimental mRNA technology that supposedly would allow rapid deployment, waiving the usual pre-clinical and animal studies.

The fact that an entirely new RNA vaccine technology which has never been used before in humans is a danger signal that should not be ignored. Several of the US candidates (Moderna, Pfizer/BioNTech, and Arcturus Therapeutics) are using this never-before-approved technology. Exogenous mRNA is inherently immunostimulatory, and this feature of mRNA could be beneficial or detrimental. It may provide adjuvant activity and it may inhibit antigen expression and negatively affect the immune response. The paradoxical effects of innate immune sensing on different formats of mRNA vaccines are incompletely understood. Potential safety concerns include local and systemic inflammation, biodistribution and persistence of expressed immunogen, stimulation of auto-reactive antibodies, and potential toxic effects of non-native nucleotides and delivery system components. A mRNA-based vaccine could also induce potent type I interferon responses, which have been associated not only with inflammation but also potentially with autoimmunity. Another potential safety issue could derive from the extracellular RNA which has been shown to increase the permeability of tightly packed endothelial cells and may promote blood coagulation and pathological thrombus formation. (10)

Another danger of mRNA vaccines is the use of biotech “carrier systems” involving lipid nanoparticles (LNPs). LNPs “encapsulate the mRNA constructs to protect them from degradation and promote cellular uptake,” and additionally, rev up the immune system. The LNP formulations in the three mRNA Covid-19 vaccines are also “PEGylated,” meaning that the vaccine nanoparticles are
coated with a synthetic, non-biodegradable and increasingly controversial polymer called polyethylene glycol (PEG). LNPs could contribute to one or more of the following: immune reactions, infusion reactions, complement reactions, opsonation reactions, antibody reactions or reactions to the PEG from some lipids or PEG otherwise associated with the LNP, as well as adverse reactions within liver pathways or degradation of the mRNA or the LNP, any of which could lead to significant adverse events. Furthermore, PEG can also provoke severe neuropsychiatric symptoms in offsprings, including mood swings, rage, phobias and paranoia. Investigators who once assumed that the polymer was largely “inert” are now questioning its biocompatibility and warning about PEGylated particles’ promotion of tumor growth and adverse immune responses that include “probably underdiagnosed” life-threatening anaphylaxis. This is a significant concern since a 2016 US study reported detectable and sometimes high levels of anti-PEG antibodies (including first-line-of-defense IgM antibodies and later-stage IgG antibodies) in approximately 72% of contemporary human samples and about 56% of historical specimens from the 1970s through the 1990s. The manufacturers of genetically engineered adenoviral vector COVID-19 vaccines undergoing clinical trials (Johnson & Johnson, Oxford, and CanSino) also use PEG as an inexpensive additive for vaccine storage. If one of the PEGylated mRNA vaccines for Covid-19 gains approval, the increased exposure to PEG will be unprecedented and potentially disastrous. (11,12)

Like the mRNA vaccines, the adenoviral vector COVID-19 vaccines are still experimental and have not been used before in mass vaccination for infectious diseases. Given the history of poor safety record of many vaccines, the risk of unpredictable and potentially disastrous adverse effects is of utmost concern.

For example, among other dangers, the virus-vectored vaccines could undergo recombination with naturally occurring viruses and produce hybrid viruses that could have undesirable properties affecting transmission or virulence. The numerous variables affecting the probability that recombination will take place and the possible outcomes of recombination are practically impossible to quantify accurately given existing tools and knowledge. The risks, however, are real, as exemplified by the emergence of mutant types of viruses, enhanced pathogenicity and unexpected serious adverse events (including death) following haphazard mass vaccination campaigns and previous failed attempts to develop chimeric vaccines using genetic engineering technology.

Genetically engineered vaccines carry significant unpredictability and a number of inherent harmful potential hazards, including unintended and unwanted side effects with regard to the targeted or non-targeted individuals. Potential undesirable immunological effects include unexpected immunopathological reaction, autoimmune reaction, long-term tolerance, persistent infection and latent infections. There is also the potential to transfer or recombine genetic material from genetically engineered viruses or GE virus-vector vaccines to the targeted individual germ line cells. It can also undergo chromosomal integration or insertional mutagenesis, leading to random insertions of vaccine constructs into host cellular genomes, resulting in alterations of gene expression or activation of cellular oncogenes, thus raising the possibility of inducing tumors. Even minor genetic changes in, or differences between, viruses can result in dramatic changes in transmission abilities, host preferences, and virulence. The new, hybrid virus progenies resulting from such events may have completely unpredictable characteristics. Virulence reversion, for example, was documented when a live recombinant vaccinia–rabies glycoprotein virus vaccine prepared for wild raccoons and foxes infected a 28-yr-old pregnant woman. (13) Virulence reversion was also documented when recombination between commercial infectious laryngotracheitis virus (ILTV) vaccines in poultry has resulted in virulent recombinant viruses that caused severe disease and that have emerged as the dominant field strains in important poultry producing regions in Australia. (14)

The risks of recombination was actually raised earlier in a meeting convened by the World Health Organization in 2003, wherein regulators representing the European Union, the US, China, and Canada raised the specific issue on recombination: “Recombination of a live virus-vectored vaccine with a circulating or reactivated latent virus could theoretically generate a more pathogenic strain…The risk of recombination should be studied if possible in a non-clinical model system, but should also be considered in clinical study designs.” This was listed among the “recommendations to WHO and priorities for future work” as one of several “issues of critical importance to be investigated further.” (15) Apparently, however, the WHO, governments and the vaccine industry never took this recommendation seriously. This comes as no surprise, given the history of WHO’s rapid approval and endorsement of several such live virus-vectored vaccines without the necessary and thorough safety studies, made especially concerning during the current mad scramble for a COVID-19 vaccine.

There’s also a concern that some people may already be immune to the adenovirus carrying the coronavirus gene into the body since adenoviruses circulate through the human population making the vaccine ineffective. (16) Data on the initial clinical trial of the adenoviral vector COVID-19 vaccine made by CanSino Biologics of China that was published in the Lancet showed that in the highest of the three doses used in the study, the number of side effects was high — 75% of the people in the highest dose group reported at least one side effect. Side effects included fever — pain at the injection site, headache, fatigue, among others. Ten volunteers (9% of the overall study group) had Grade 3 side effects, defined as “serious and medically significant symptoms,” six (17%) in the highest dose group and two (6%) each in the low and middle dose groups. The study also found that one dose of the vaccine, tested at three different levels, appeared to induce a good immune response in some subjects. But about half of the volunteers — people who already had immunity to the backbone of the vaccine — had a dampened immune response. (17)

The Dengvaxia vaccine fiasco in the Philippines also illustrates the danger of rushing a vaccine and allowing corporate interests driven by market forces to address people’s health needs. As a result, many of the vaccinated suffered or died after a botched mass vaccination program.(18) According to the Chief Pathologist of the Public Attorney’s Office, 153 of those vaccinated with Dengvaxia had died as of February 18, 2020. (19)

Another example of the danger of corporate fast-tracking of vaccine clinical safety trials is the case of the HPV (Human Papilloma Virus) vaccine. Two of the biggest vaccine manufacturers spiked their placebos with a neurotoxic aluminum adjuvant and cut observation periods. Numerous adverse events, including life-threatening injuries, permanent disabilities, hospitalizations and deaths, were later reported after vaccination with bivalent, quadrivalent or nine-valent HPV vaccines. The company scientists routinely dismissed, minimized or concealed those injuries using statistical gimmicks and invalid comparisons designed to diminish their relative significance. Some regulatory agencies were complicit in covering up increased incidence of adverse effects in post-marketing surveillance studies.(20, 21)

Another concern is that vaccines produced with cell cultures are often contaminated with naked nucleic acids, genomic fragments, retroviruses and other foreign materials that carry uncertain but potentially serious hazards. This contamination may be present in the source material, e.g. human blood, human or animal tissues, cell banks, or introduced in the manufacturing process through the use of animal sera. Many candidate COVID-19 vaccines are produced on what is called “immortal” cell lines or cancerous types of cells (e.g. Vero cells derived from the African green monkey) that could spread cancer-promoting material into the human recipient. Manufacturers and authorities assure us that these do not cause tumors per se. However, scientific studies tell us that after these cells have been repeatedly cultured a certain number of times, they can convert to a cancerous state. Immortal cell lines show 100-times greater number of DNA recombination events compared to normal cells. This could result in viral-viral or viral-cellular interactions that can generate new viruses and result to pathological consequences, including autoimmunity and cancer. (22) Even the US FDA recognized this danger. In a paper published in its website, it stated: “In some cases the cell lines that are used might be tumorigenic, that is, they form tumors when injected into rodents. Some of these tumor-forming cell lines may contain cancer-causing viruses that are not actively reproducing. Such viruses are hard to detect using standard methods. These latent, or ‘quiet,’ viruses pose a potential threat, since they might become active under vaccine manufacturing conditions.” (23)

Still another concern, not only in terms of safety issues but also on moral grounds, is the use of aborted fetal cells in vaccine manufacture. Vaccines produced from human fetal cells contain cell debris and contaminating fetal DNA (together with its epigenetic modification) which cannot be fully eliminated during downstream purification. This could cause insertional mutagenesis (potentially causing cancer) and autoimmunity in the vaccinated. At least six of the COVID-19 candidate vaccines (Cansino, AstraZeneca/Oxford, Janssen, ImmunityBio/NantKwest, University of Pittsburgh and Altimmune) use one of two human fetal cell lines: HEK-293, a kidney cell line that comes from a fetus aborted in about 1972 and PER. C6, a proprietary cell line owned by Janssen, developed from retinal cells from an 18-week-old fetus aborted in 1985. (24)

There are many plausible biological mechanisms for potential adverse effects of all the vaccines in the pipeline for COVID-19. The history of vaccination is replete with scientific evidence of adverse effects through enhanced pathogenicity, mutation, recombination, induced immune system dysfunction, and various non-specific effects following vaccination despite regulatory approval and prior clinical trials and other corporate sponsored studies that were claimed to be proof of safety. The inherent danger of injecting microbial protein fragments, contaminants, DNA and other foreign materials into the human body is well documented in the scientific literature. Practically all vaccines contain such hazardous foreign fragments and materials and are unavoidably unsafe. Furthermore, exposure of the vaccinee to other environmental hazards (pesticides, air pollutants, 5G radiation, ionizing radiation, etc.) resulting to synergistic adverse effects not captured by corporate sponsored “safety” studies is also another plausible mechanism that may result in acute or long-term injury, including death.

Safety assessments under the corporate dominated scientific milieu are grossly inadequate and oftentimes erroneous. Pre-clinical studies and clinical trials are done or sponsored by the very corporations who sell the vaccines and they do not adequately address the plausible adverse effects that cannot be detected by the corporate sponsored studies. There are no independent studies that could validate the claims of the vaccine manufacturers. Therefore, there is no reason to believe that the potential benefits from an upcoming COVID-19 vaccine would outweigh the potential adverse effects, despite assurances of safety by the vaccine industry, international institutions, governments and the mainstream medical science groups.


COVID-19 Vaccine Clinical Trials

What is a Phase 3 vaccine clinical trial?

A Phase 3 trial of an investigational vaccine enrolls thousands of people to evaluate if the vaccine is safe and can effectively prevent symptomatic COVID-19 disease. All vaccine candidates being tested in OWS-supported Phase 3 clinical trials have been previously tested in early-stage clinical trials that showed they were well tolerated and elicited an immune response in adult volunteers. Participants in Phase 3 clinical trials are assigned randomly to receive either the investigational vaccine or a placebo. The trials are double-blind, meaning neither the trial investigators nor the participants know who received the vaccine candidate. Investigators evaluate if the vaccine works by comparing the number of cases of symptomatic COVID-19 in the vaccine group versus the placebo group. Participants are monitored throughout the trial for safety.

What types of COVID-19 vaccines are being evaluated in large-scale trials in the U.S.?

Please visit the NIH ACTIV vaccines page for a summary of Operation Warp Speed-supported clinical trials of COVID-19 vaccine candidates.

Viral Vector-Based Vaccines

The candidate vaccines developed by AstraZeneca and Oxford (AZD1222) and the Janssen Pharmaceutical Companies of Johnson & Johnson (JNJ-7843672 or Ad.26.COV2.S) are viral vector-based vaccines. They use a safe virus to deliver the genetic code (DNA) of the SARS-CoV-2 spike protein to human cells so that the cells can make the protein. JNJ-7843672 uses a human adenovirus to deliver the code for the SARS-CoV-2 spike protein. Adenoviruses are a group of viruses that cause the common cold. However, the adenovirus vector used in the vaccine candidate has been modified so that it can no longer replicate in humans and cause disease. Janssen uses the same vector in the first dose of its prime-boost vaccine regimen against Ebola virus disease (Ad26.ZEBOV and MVA-BN-Filo), which is licensed for use in Europe. AZD1222 uses a non-replicating chimpanzee adenovirus to deliver the code for a SARS-CoV-2 spike protein. The technology is based on a vaccine that Oxford was previously developing for Middle East respiratory syndrome coronavirus (MERS-CoV).

MRNA Vaccines

The vaccine candidates developed by Pfizer and NIH/Moderna are mRNA (messenger ribonucleic acid) vaccines. When the genetic code (DNA) of a protein is delivered to a cell, it is decoded by RNA into readable instructions. mRNA vaccines skip this step by providing directly to cells the readable instructions on how to make the SARS-CoV-2 spike protein. Lipid nanoparticles deliver the mRNA to the cell’s cytoplasm. The mRNA from a COVID-19 vaccine never enter the nucleus of the cell, which is where our DNA are kept. This means the mRNA does not alter or interact with our DNA in any way, and is eventually degraded inside the cell as part of the natural mRNA lifecycle.

Protein Subunit Vaccine

The vaccine candidate developed by Novavax, Inc., (NVX CoV2373) is a protein subunit vaccine that contains a stabilized form of the SARS-CoV-2 spike protein using the company’s recombinant protein nanoparticle technology. Other COVID-19 vaccines under development are nucleic acid vaccines that deliver instructions for cells to make the protein, whereas protein subunit vaccines deliver the protein directly.

How are the trials of COVID-19 vaccines aligned?

A clinical trial protocol is developed by the trial sponsor and stipulates why and how the trial is being conducted. The protocol covers the scientific rationale for the trial, its key objectives, the design and methodology, which populations can and cannot enroll, when and how efficacy is analyzed, how safety is monitored, statistical considerations and other issues.

All OWS Phase 3 trials are randomized and placebo-controlled, which is the gold standard for rigorous clinical research. NIH experts, through the Accelerating COVID-19 Therapeutic Interventions and Vaccines (ACTIV) public-private partnership, helped to ensure the protocols of all OWS-supported Phase 3 trials of investigational vaccines use the same laboratory tests and are designed to evaluate a similar primary endpoint: whether the vaccine can prevent symptomatic COVID-19. This approach enables transparent evaluation of the relative performance of each vaccine approach across trials. The trials also share a common Data and Safety Monitoring Board, an independent body which is there to oversee study scientific rigor and volunteer safety.

More information on the harmonized approach to clinical trials of COVID-19 vaccines is covered by NIH experts in a May 29, 2020, Policy Forum in the journal Science, titled “A strategic approach to COVID-19 vaccine R&D.”

How long will the trials take to complete?

Each trial is designed to follow participants and collect safety and immunogenicity data for about two years. However, a trial can be temporarily paused or stopped due to safety issues, futility or strong evidence of efficacy. It is difficult to predict exactly how long it will take to generate enough data to determine the safety and efficacy of various vaccine candidates because that depends on the actual incidence of SARS-CoV-2, the virus that causes COVID-19. The trials are event-driven (case-driven), meaning that statisticians have estimated that a certain number of cases of COVID-19 among trial participants (around 150-160) must be observed for a high probability of detecting a percent reduction in disease incidence in the vaccinated group compared to the placebo group that is not due to chance. The primary analysis occurs once this threshold of cases has been observed. The trial protocols also stipulate if and when the Data and Safety Monitoring Board (DSMB) can perform interim analyses before reaching the point for primary analysis.

Why can’t certain populations like children and pregnant women enroll in the current COVID-19 trials?

It is common practice to first evaluate the safety and efficacy of an investigational vaccine in adult volunteers before evaluating in children and pregnant women. However, OWS recognizes the importance of vaccine-induced protection in all populations, including children and pregnant women. OWS is accelerating preclinical assessments of potential developmental and reproductive toxicity to anticipate any safety concerns, as recommended per guidance from the Food and Drug Administration. Assuming those assessments show no safety concerns, OWS intends to conduct safety and immunogenicity studies in pregnant women and children, in partnership with industry. The immune responses in those studies would be compared to the immune responses from Phase 3 trials of non-pregnant adults (known as “immunobridging”).

How is NIAID working to ensure diversity among volunteers in the vaccine clinical trials? Why is enrolling diverse groups important?

Long-standing systemic health and social inequities have put many people from racial and ethnic minority groups at increased risk of getting sick and dying from COVID-19. Race and ethnicity are risk markers for other underlying conditions that impact health — including socioeconomic status, access to health care, and increased exposure to the virus due to occupation (e.g., frontline, essential, and critical infrastructure workers). According to the CDC, people who are Black or African American, Hispanic or Latino, American Indian or Alaska Native and Asian are more likely to die from COVID-19. Black and African American people are 3.7 times more likely to be hospitalized for COVID-19 as compared to white people. Hispanic or Latino people are 4.1 times more likely to be hospitalized, American Indian or Alaska Native people are 4 times as likely to be hospitalized, and Asian people are 1.2 times as likely to be hospitalized.

It is important that U.S. clinical trials enroll a volunteer population that at least reflects the diversity of the U.S. population, or more ideally—reflects the population of those at increased risk of COVID-19.

The NIAID-funded COVID-19 Prevention Network (CoVPN) is working with stakeholders to reach priority populations, including Native Americans, Black Americans (including African Americans), the Latinx community, people who are at higher risk of exposure to SARS-CoV-2 infection due to occupation, people with pre-existing health conditions, people living in assisted living facilities and communities experiencing health disparities.

The NIH Community Engagement Alliance (CEAL) Against COVID-19 Disparities is conducting outreach and seeking input from communities to raise awareness about COVID-19 and to address misinformation and mistrust about the pandemic and efforts to combat it. CEAL also is working to ensure that COVID-19 prevention and treatment clinical trials include racially and ethnically diverse communities most affected by the pandemic.

What is a Data and Safety Monitoring Board (DSMB)? What is unique about the Operation Warp Speed vaccine DSMB?

A DSMB is an independent group of experts from various relevant disciplines who oversee and monitor clinical trials to ensure participant safety and the validity and integrity of the data. OWS-supported Phase 3 vaccine trials are overseen by a common DSMB (meaning the same DSMB for multiple trials). The OWS DSMB includes members with expertise in ethics, statistics, vaccine development, patient care and clinical trials. Their role is to advise a group composed of the study sponsor, NIAID and BARDA.

The DSMB members meet before each study starts to review the protocol and statistical monitoring plan. After that point, the DSMB meets according to the schedule laid out in the protocol. At all regularly scheduled meetings, there is an open and closed session. The DSMB reviews interim and final data on safety and efficacy at prespecified points throughout a study and makes recommendations to the sponsor regarding whether a protocol should be amended, or the study should proceed or be paused or terminated.

What is NIAID’s role in relation to the DSMB?

NIAID formed the OWS DSMB and invited the members. A NIAID employee serves as the executive secretary.

The DSMB provides recommendations to an oversight group composed of the study sponsor, NIAID and BARDA. If there is no consensus among the oversight group, which is rare, the ultimate decision belongs to the sponsor. NIAID Director Anthony S. Fauci, M.D., serves as the designated senior representative of the United States government for the oversight group. He does not participate in the DSMB process of developing recommendations regarding a clinical trial.

Who is part of the OWS DSMB?

The DSMB is composed of a group of experts from various relevant disciplines. The names of DSMB members are confidential to protect the integrity of the process. The only time DSMB members are named is when a study has concluded and then, only with their express permission, they may be named in the acknowledgments section of a published manuscript for the study on which they served. Each member receives a modest honorarium for each meeting and is responsible for disclosing any potential conflict of interest.

Are vaccine trials safe?

Researchers first evaluate experimental vaccines in the laboratory and animal models. If a vaccine candidate is safe and appears promising in these preclinical experiments, it may go on to be carefully tested in people. Experimental vaccines undergo several phases of clinical testing to establish their safety and efficacy. After a vaccine is licensed or issued an Emergency Use Authorization, FDA, CDC, and other federal agencies continue to monitor its safety.

Developing safe vaccines and ensuring the safety of the volunteers who participate in vaccine clinical trials are of the utmost importance. By their nature, all clinical trials involve the assumption of some level of risk. The risk assumed by well-informed adult volunteers could have enormous benefit to society by accelerating the development of safe and effective vaccines during this pandemic. All vaccine candidates being tested in OWS-supported Phase 3 clinical trials have been previously tested in early-stage clinical trials in which they were found to be well tolerated and prompted an immune response in adult volunteers.

People can say yes or no when invited to join a study of a COVID-19 vaccine candidate. All study volunteers must go through a process called informed consent that ensures they understand potential risks and benefits of being in a study. They also may leave a study at any time. Study sites make every effort to ensure that people understand the study fully before they decide whether to join. The trials adhere to U.S. federal regulations on research, as well as international ethical standards.

Clinical trial participants are very closely monitored for side effects attributable to the experimental vaccine. Most commonly, vaccine side effects are temporary and may include soreness or redness at the injection site, and less commonly, fever. Very rarely, a person may experience a serious adverse event. Clinical trial participants also are counseled on steps to take to minimize the possibility of contracting COVID-19 in their communities.

What is a clinical trial pause?

It is not unusual for clinical trials to pause enrollment when a safety event occurs, which has happened with a few clinical trials of vaccines and therapeutics for COVID-19. Study protocols delineate the type of safety events that must lead to an extra level of review and a halt or pause on new enrollment. This illustrates the extent to which safeguards for volunteer safety are built into clinical trials. A pause in a trial is a sign that the system is working. A study sponsor decides to initiate a pause.

What is a clinical hold?

Another type of study halt is known as a clinical hold. The Food and Drug Administration (FDA) oversees the conduct of clinical trials in the U.S. and can issue a clinical hold, requiring the sponsor to respond to various questions before the trial can resume.

What happens after a Phase 3 clinical trial establishes a vaccine is safe and effective?

A clinical trial must first establish a vaccine candidate’s safety and efficacy before it can be made widely available. Any COVID-19 vaccine candidate will follow this process before people can receive the vaccine outside of a clinical trial:

  1. Safety and Efficacy Established
  2. FDA Reviews and Authorizes
  3. CDC Issues Recommendations on Vaccine Use
  4. Vaccine is Distributed

Safety and Efficacy Established

The Data and Safety Monitoring Board (DSMB) reviews trial data and informs the sponsor, NIH and BARDA that the trial has reached a predefined “stopping point” for efficacy. This means there is enough evidence to show that the vaccine can effectively prevent symptomatic COVID-19 in participants. Even if a “stopping point” is reached, the trial staff will continue to follow participants and may remain blinded. In addition, the trials are still allowing adequate time to ensure enough safety data is collected before a vaccine is widely distributed. The DSMB will play a key role in advising how a trial should proceed ethically once a stopping point is reached.

FDA Reviews and Authorizes

FDA's Center for Biologics Evaluation and Research (CBER) is responsible for regulating vaccines in the United States. If successful, the completion of all three phases of clinical development can be followed by a request for an Emergency Use Authorization (EUA) or the submission of a Biologics License Application (BLA).

The CBER Vaccines and Related Biological Products Advisory Committee (VRBPAC) met in October 2020 to discuss, in general, the development, authorization and/or licensure of vaccines to prevent COVID-19. This non-FDA expert committee (scientists, physicians, biostatisticians, and a consumer representative) provides advice to the FDA regarding the safety and efficacy of the vaccine for the proposed indication. VRBPAC is reviewing requests for EUA and license applications for all COVID-19 vaccines. See FDA’s Emergency Use Authorization for Vaccines Explained for more information.

CDC Issues Recommendations on Vaccine Use

CDC makes COVID-19 vaccination recommendations for the United States based on input from the Advisory Committee on Immunization Practices (ACIP). ACIP is a federal advisory committee made of up of medical and public health experts who develop recommendations on the use of vaccines in the U.S. public.

If the Food and Drug Administration (FDA) authorizes or approves a COVID-19 vaccine, ACIP convenes to review all available data about that vaccine. From these data, ACIP will then vote on whether to recommend the vaccine and for which populations. ACIP’s recommendations also include guidance on who should receive COVID-19 vaccines if supply is limited. Recommendations must go to the director of CDC for approval before becoming official CDC policy.

Vaccine is Distributed

The CDC, per initial guidance from ACIP, has outlined priority populations who will receive the vaccine first. Generally, it will take several months before COVID-19 vaccines are widely available to the general public.

The Department of Defense is helping to coordinate vaccine distribution logistics in the United States. While the Department of Defense is overseeing this process, it is important to note that military personnel will not be physically vaccinating people in the U.S., although some states may opt to use their National Guard medical corps for assistance.

The CDC notes that the federal government will oversee a centralized system to order, distribute, and track COVID-19 vaccines. All vaccines will be ordered through CDC. Vaccine providers will receive vaccines from CDC’s centralized distributor or directly from a vaccine manufacturer. For more information, see Frequently Asked Questions about COVID-19 Vaccination.

How did NIAID research contribute to the early development of COVID-19 vaccines now in late-stage clinical testing?

Building on previous research on SARS and MERS, NIAID scientists and grantees were positioned to rapidly develop COVID-19 vaccines, therapeutics and diagnostics. These projects include conducting basic research to understand how the virus infects cells and causes disease, and what interventions can prevent and stop the spread of disease.

Scientists at NIAID’s Vaccine Research Center in Bethesda, Maryland have spent years researching the structure and function of coronaviruses to make highly targeted vaccines. Together with their academic collaborators, their pivotal work prior to the COVID-19 pandemic revealed that a stabilized version of the spike protein found on the surface of all coronaviruses can be a key target for vaccines, therapeutics and diagnostics. All coronavirus particles are spherical and have mushroom-shaped proteins called spikes protruding from their surface, giving the particles a crown-like appearance. The spike binds and fuses to human cells, allowing the virus to gain entry. However, the spike undergoes a massive rearrangement as it fuses the virus and cell membranes. VRC researchers and their colleagues (Andrew Ward at Scripps and Jason McLellan at Dartmouth) solved the spike structure. VRC and Dr. McLellan (now at University of Texas, Austin) found that the spike stabilized in its prefusion conformation is more likely to preserve targets for infection-blocking antibodies induced by a vaccine. Thanks to years of prior research, once the genome of a SARS-CoV-2 virus isolate was shared by researchers in China in early 2020, NIAID VRC scientists and their UT collaborators were able to quickly confirm that the SARS-CoV-2 stabilized prefusion spike protein would be a candidate vaccine antigen. Their research revealing the atomic-level structure of the SARS-CoV-2 spike protein is supporting discovery of antiviral therapeutics in addition to precision vaccine design.

NIAID scientists based at Rocky Mountain Laboratories in Hamilton, Montana, also have been collaborating with Oxford University investigators to conduct preclinical studies on Oxford’s chimpanzee adenovirus-vectored vaccine candidate against MERS-CoV and quickly transitioned to preclinical studies of Oxford’s candidate for SARS-CoV-2 (AZD1222), now licensed to AstraZeneca for further development.

How can I volunteer for a COVID-19 vaccine clinical trial?

Those interested in participating in a COVID-19 vaccine clinical trial can visit preventcovid.org.

Where can I find more information about participating in a COVID-19 treatment clinical trial?

Those interested in participating in COVID-19 clinical trials can visit https://combatcovid.hhs.gov/.

When will participants in the Moderna and Pfizer/BioNTech vaccine trials who received a placebo gain access to the vaccine?

The study sponsors (Moderna and Pfizer/BioNTech), in consultation with the FDA, are establishing plans to offer the vaccines to participants who were randomized to receive placebo as part of the trial. Please contact the study sponsors directly for more information.

Will placebo-controlled trials of other COVID-19 vaccine candidates continue once the Moderna and Pfizer vaccines receive EUA? Will new placebo-controlled trials begin?

Additional Operation Warp Speed-supported placebo-controlled trials initiated before the Moderna and Pfizer/BioNTech vaccines were made available are still underway. The trials are evaluating investigational vaccines developed by AstraZeneca and the Janssen Pharmaceutical Companies of Johnson & Johnson.

Another Operation Warp Speed-supported trial evaluating an investigational COVID-19 vaccine developed by the biotechnology company Novavax, Inc., began in late December 2020. It is important to continue to conduct rigorous trials of multiple types of COVID-19 vaccines to ensure we have an array of options. One-size-fits-all preventions do not always provide the best fit for everyone. COVID-19 vaccines initially available to certain priority populations are being authorized by the Food and Drug Administration under a mechanism known as Emergency Use Authorization (EUA). The issuance of an EUA is different than an FDA approval (licensure) of a vaccine. A vaccine available under emergency use authorization is still considered investigational. A placebo-controlled trial remains appropriate until a COVID-19 vaccine is approved for use and widely available in the U.S. At that point, a head-to-head clinical trial design comparing the investigational vaccine to the licensed vaccine would be appropriate.


SUPPLEMENTARY INFORMATION

Supplementary table 1: Scoring results for all baits and all proteins

Supplementary table 2: SARS-CoV 2 high confidence interactors

Supplementary table 3: Literature-derived drugs and reagents that modulate SARS-Cov-2 interactors. Drug-target associations drawn from chemoinformatic searches of the literature, including information about purchasability

Supplementary table 4: Expert-identified drugs and reagents that modulate SARS-CoV-2 interactors. Drug-target associations drawn from expert knowledge of human protein interactors of SARS-Co-V2 and reagents and drugs that modulate them not readily available from the chemoinformatically-searchable literature

Supplementary table 5: Raw chemical associations to prey proteins IUPHAR/BPS Guide to Pharmacology (2020-3-12)

Supplementary table 6: Raw chemical associations to prey proteins ChEMBL25

Supplementary Methods: Computational methods used to propagate tables and supplemental figures

Supplementary Discussion: In depth look at the SARS-CoV-2 individual bait subnetworks



Comments:

  1. Farnell

    I apologise, there is an offer to go on other way.

  2. Shadal

    I think you are wrong. I can defend my position. Write to me in PM.

  3. Garred

    Here is a steering wheel!

  4. Kaganris

    Nothing at all.

  5. Dilar

    Well done, it seems to me, that's the remarkable sentence

  6. Ody

    I believe that you are making a mistake. Let's discuss.

  7. Ualtar

    I can look for the reference to a site on which there is a lot of information on this question.

  8. JoJozilkree

    I find that you are not right. Write in PM, we will communicate.



Write a message