Information

13.6: Integrins - Biology

13.6: Integrins - Biology


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

The integrins have thus far been introduced as receptors for fibronectin and laminin, but it is a large family with a wide variety of substrates. For example, the focal adhesion (Figure (PageIndex{8})) shows an an integrin receptor bound to collagen. As already discussed in the previous chapter, focal adhesions are usually transient, and seen as points of contact as fibroblasts or other migratory cells crawl on a culture dish or slide coated with ECM proteins.

In addition to collagen, fibronectins and laminins are also potential binding partners for integrins. As table 1 shows, the diversity of subunits and combinations means that integrins are involved in a wide array of cellular processes, and can bind cell surface proteins as well as ECM.

Table 1: Integrin receptors, their ligands and distribution.
SubunitsLigandDistribution
α1β1mostly collagens, also lamininwidespread
α2β1mostly collagens, also lamininwidespread
α4β1fibronectin, VCAM-1hematopoietic cells
α5β1fibronectinfibroblasts
α6β1lamininwidespread
α6β4lamininepithelial cells
αLβ2ICAM-1, ICAM-2T-lymphocytes
αllbβ3fibronectin, fibrinogenplatelets

With this variety, it is not surprising that not all integrins bind RGD sequences, although most do. For example, α2β1 integrins prefer YYGDLR or FYFDLR sequences, and αIIbβ3 binds both the RGD and a KQAGDV sequence strongly. Integrin activation has been shown to initiate signaling pathways, beginning focal adhesion kinase (FAK) or a few other central kinases, which control activities from cytoskeletal rearrangement to cell survival.

Both α and β subunits are transmembrane proteins that pass through the membrane just once. Evolutionarily, they are found only in metazoan species, but they are also found in all metazoan species. All integrins but one, α6β4, connect to the actin microfilament cytoskeleton through the b subunit cytoplasmic domain. The α6β4 integrin links to the intermediate filament cytoskeleton, in part because the β4 cytoplasmic domain is very large and extends further into the cytoplasm. On the extracellular side, there is a metal ion coordination site usually occupied by Mg2+, that is necessary for ligand binding. There are also several other divalent ion binding sites, The receptor can be found in either an inactive (somewhat bent over towards the membrane) or an active state (straightened up). In the inactive state, the a subunit binds the β subunit closely preventing interaction with the cytoskeleton. However, once a subunit cytoplasmic domain, it displaces the a subunit, causing a slight separation of the two subunits and leading to activation of the receptor. In fact, integrins demonstrate what is known as “inside-out” signaling, in which a cellular signal (for example, from the signaling cascade of a growth factor) leads to alterations to the cytoplasmic domain and which shifts the conformation of the extracellular domain to an active straightened-up state in which it can more readily bind to ligands. This is why integrins are so well suited to focal adhesions and other “in motion” adhesions that must adhere and release quickly. Though recycling of receptors also happens, turning them on or off by inside-out signaling is an effective mechanism for fast movement.

As one might expect from an actin-linked structure, focal adhesions and their in vivo equivalents are transient, dynamic points of contact between the cell and the substrate it is crawling over. However, there are many situations in which a cell is not only stationary, it needs to be firmly attached to its substrate in order to gird itself for what- ever stressors might come to test its resolve. In these cases, the actin cytoskeleton is too ephemeral for the task.


Research activities

Our research aims to understand how cells respond to changes of mechanical properties of their surrounding environment. We combine biochemistry, molecular biology and quantitative biophysics approaches to investigate the molecular mechanisms that control nuclear structure and function in response to mechanical stress. Recent projects focus on: How the nucleoskeleton regulates gene expression in vascular cells and in neuronal progenitors, and how intercellular transmission of mechanical signals regulates collective behavior within epithelium.

Staff

Christophe Guilluy, PhD (Group Leader) [email protected]

Aureille J, Buffière-Ribot V, Harvey BE, Boyault C, Pernet L, Andersen T, Bacola G, Balland M, Fraboulet S, Van Landeghem L, Guilluy C . Nuclear envelope deformation controls cell cycle progression in response to mechanical force. EMBO Rep. 2019

Guilluy C , Osborne L, Van Landeghem L, Superfine R, Garcia-mata R and Burridge K. Isolated nuclei adapt to force and reveal a mechanotransduction pathway within the nucleus. Nat Cell Biol. 2014 Mar 9. doi: 10.1038

Guilluy C , Swaminathan V, Garcia-Mata R, O’Brien ET, Superfine R, Burridge K. The Rho GEFs LARG and GEF-H1 regulate the mechanical response to force on integrins. Nat Cell Biol. 2011 Jun13(6):722-7

Guilluy C , Burridge K. Nuclear mechanotransduction: forcing the nucleus to respond. Nucleus. 20156(1):19-22

Collins C, Guilluy C , Welch C, O’Brien ET, Hahn K, Superfine R, Burridge K, Tzima E. Localized tensional forces on PECAM-1 elicit a global mechanotransduction response via the integrin-RhoA pathway. Curr Biol. 2012 Nov 2022(22):2087-94

Thompson WR, Guilluy C , Xie Z, Sen B, Brobst KE, Yen SS, Uzer G, Styner M, Case N, Burridge K, Rubin J.Mechanically activated Fyn utilizes mTORC2 to regulate RhoA and adipogenesis in mesenchymal stem cells. Stem Cells. 2013 Nov31(11):2528-37

Sandrine Fraboulet, PhD (Associate Professsor)[email protected]

Selected publications

V. Mercier, M.H. Laporte, O. Destaing, B. Blot, C.M. Bloin, K. Pernet-Gallay, C. Chatellard, Y. Saoudi, C. Albigez-Rizo, C. Lamaze, S. Fraboulet , A. Petiot, R. Sadoul. ALG-2 interacting protein-X (Alix) is essential for clathrin-independent endocytosis and signaling. Scientific Report. 2016 (6):26986

Chassefeyre, J. Martinez-Hernández, F. Bertaso, N. Bouquier, B. Blot, M. Laporte, S. Fraboulet , Y. Couté, A. Devoy, A. Isaacs, K. Pernet-Gallay, R. Sadoul, L. Fagni, Y. Goldberg. Regulation of post- synaptic function by the dementia-related ESCRT-III subunit chmp2b. Journal of Neuroscience. 2015 18 35(7):3155-73. Erratum in: J Neurosci. 2015 May 20 35(20): 8035-7.

Chivet, F. Hemming, K. Pernet-Gallay, S. Fraboulet , R. Sadoul. Emerging role of neuronal exosomes in the central nervous system. Front Physiol. 2012 3:145.

Briese, B. Esmaeili, S. Fraboulet , E.C. Burt, S. Christodoulou, P.R. Towers, K.E. Davies, D.B. Sattelle. Deletion of smn-1, the Caenorhabditis elegans orthologue of the spinal muscular atrophy gene, results in locomotor dysfunction and reduced lifespan. Hum Mol Genet. 2009 18(1):97-104.

A.L. Mahul-Mellier, F. Strappazzon, A. Petiot, C. Chatellard-Causse, S. Torch, B. Blot, K. Freeman, L. Kuhn, J. Garin, J.M. Verna, S. Fraboulet , R.Sadoul. Alix and ALG-2 are involved in TNF-R1 induced cell death. J. Biol. Chem. 2008 283(50):34954-65.

Monika Elzbieta Dolega, PhD (Research Associate) [email protected]

Selected publications

Dolega ME , Delarue M, Ingremeau F, Prost J, Delon A, Cappello G. Cell-like pressure sensors reveal increase of mechanical stress towards the core of multicellular spheroids under compression. Nat. Commun. 2017 Jan 278:14056. doi: 10.1038/ncomms14056.

Dolega ME , Abeille F, Picollet-D’hahan N, Gidrol X. Controlled 3D culture in Matrigel microbeads to analyze clonal acinar development. Biomaterials. 2015 Jun52:347-57. doi: 10.1016/j.biomaterials.2015.02.042. Epub 2015 Mar 3.

Dolega ME , Wagh J, Gerbaud S, Kermarrec F, Alcaraz JP, Martin DK, Gidrol X, Picollet-D’hahan. Facile bench-top fabrication of enclosed circular microchannels provides 3D confined structure for growth of prostate epithelial cells. PLoS One. 2014 Jun 199(6):e99416. doi: 10.1371/journal.pone.0099416. eCollection 2014.

Lydia Pernet, PhD (Engineer) [email protected]

Responsabilities in the lab:

– Experiments in biochemistry, molecular and cellular biology
– Cell culture line maintenance
– Development of ATACseq experiments

– Molecular biology -> qPCR
– Health & Safety à Prevention Assistant and workplace first-aider

– In charge of the culture room maintenance
– Students supervision
– Purchasing manager


Uncoupling integrin adhesion and signaling: the βPS cytoplasmic domain is sufficient to regulate gene expression in the Drosophila embryo

Integrin cell surface receptors are ideally suited to coordinate cellular differentiation and tissue assembly during embryogenesis, as they can mediate both signaling and adhesion. We show that integrins regulate gene expression in the intact developing embryo by identifying two genes that require integrin function for their normal expression inDrosophila midgut endodermal cells. We determined the relative roles of integrin adhesion versus signaling in the regulation of these integrin target genes. We find that integrin-mediated adhesion is not required between the endodermal cells and the surrounding visceral mesoderm for integrin target gene expression. In addition, a chimeric protein that lacks integrin-adhesive function, but maintains the ability to signal, can substitute for the endogenous integrin and regulate integrin target genes. This chimera consists of an oligomeric extracellular domain fused to the integrin βPS subunit cytoplasmic domain a control monomeric extracellular domain fusion does not alter integrin target gene expression. Therefore, oligomerization of the 47-amino-acid βPS intracellular domain is sufficient to initiate a signaling pathway that regulates gene expression in the developing embryo.


Publications

Campbell, H., Salvi, A., O’Brien II, E.T., Superfine, R., & DeMali, K. (2019). “PAK2 links cell survival to mechanotransduction and metabolism.” Journal of Cell Biology 218(6): 1958-1971. PMC6548143

Liu, B., Hobson, C.M., Pimenta, F.M., Nelsen, E., Hsiao, J., O’Brien, E.T., Falvo, M.R., Hahn, K.M., and Superfine, R. (2019). “VIEW-MOD: a versatile illumination engine with a modular optical design for fluorescence microscopy.” Optics Express 27(14): 19950-19972. NIHMS1053869

Marston DJ, Anderson, K.L., Swift, M.F., Rougie, M., Page, C., Hahn, K.M., Volkmann, N., and Hanein, D. (2019). High Rac1 activity is functionally translated into cytosolic structures with unique nanoscale cytoskeletal architecture. PNAS. 116(4):1267-72. Epub 2019 Jan 10. PMC6347697. PDF

Beicker K, O’Brien III, E.T., Falvo, M.R., and Superfine, R. (2018). Vertical Light Sheet Enhanced Side-View Imaging for AFM Cell Mechanics Studies. Scientific Reports. 8(1504). 8(1): 1504. PMC5784156. PDF

Carpenter J, Lynch, S.E., Cribb, J.A., Kylstra, S., Hill, D.B., & Superfine, R. (2018). Buffer drains and mucus is transported upward in a tilted mucus clearance assay. American Journal of Physiology – Lung Cell Molecular Physiology. Epub 2018 Sep 13. DOI 10.1152/ajplung.00274.2018.PMC6295511 PDF

Dagliyan O, Krokhotin, A., Ozkan-Dagliyan, I., Deiters, A., Der, C.J., Hahn, K.M, Dokholyan, N.V. (2018). Computational design of chemogenetic and optogenetic split proteins. Nature Communications. 9(1):4042. PMC6168510. PDF

Eicher JE, Kapustina, M., Falvo, M., and Jacobson, K. Determination of 3D Amoeboid Migration Force through Utilization of Actuated Surface Attached Posts. biophysical Journal San Francisco, CA 2018. p. 16A-7A. Abstract PDF

Judith RM, Lanham, B., Falvo, M.R., & Superfine, R. (2018). Microfluidic viscometry using magnetically actuated micropost arrays. PloS one. 13(7):e0200345. PMC6049921 PDF

Ma X, Dagliyan, O., Hahn, K.M., and Danuser, G., (2018). Profiling Cellular Morphodynamics by Spatiotemporal Spectrum Decomposition. PLoS Computational Biology. 14(8):e1006321. Epub 2018 Aug. doi. 10.1371/journal.pcbi.1006321. PMC6091976. PDF

Nelsen E, Hobson, C., Hsiao, J., Falvo, M., O’Brien III, E.T., Watanabe, T., Hahn, K., and Superfine, R. Force Spectroscopy of Phagocytosis with High Frame Rate 3D Light Sheet Imaging. 62nd Annual Meeting of the Biophysical Society San Francisco, CA 2018. p. 530A. Abstract PDF

Shao C, Cribb, J., Osborne, L.D., O’Brien III, E.T., Superfine, R., Mayer-Patel, K., and Taylor II, R.M. (2018). Analysis-aware microscopy video compression. Microscopy Research Technique. 81(7):693-703. PDF

Stefanini L, Lee, R.H., Paul, D.S., O’Shaughnessy, E.C., Ghalloussi, D., Jones, C.I., Boulaftali, Y., Poe, K.O., Piatt, R., Kechele, D.O., Caron, K.M., Hahn, K.M., Gimmins, J., M., and Bergmeier, W., (2018). Functional redundancy between RAP1 isoforms in murine platelet production and function. Blood. 132(18):1951-62. Epub 2018 Aug 21. PMC6213319. PDF

Tarbet HJ, Dolat, L., Smith, T.J., Condon, B.M., O’Brien III, E.T., Vladivia, R.H., and Boyce, M. (2018). Site-specific glycosylation regulates the form and function of the intermediate filament cytoskeleton ELIFE. 7. Epub Mar 7 2018. PMC5841932 PDF

Tajadura-Ortega, V., Garg, R., Allen, R., Owczarek, C., Bright, M.D., Kean, S., Mohd-Noor, A., Grigoriadis, A., Elston, T.C., Hahn, K.M., Ridley, A.J. (2018). An RNAi Screen of Rho signalling networks identifies RhoH as a regulator of Rac1 in prostate cancer cell migration. BMC Biology. 16(1): 29. PMC5840776. PDF

Van Haren J, Charafeddine, R.A., Ettinger, A., Wang, H., Hahn, K.M., and Wittman, T. (2018). Local Control of Intracellular Microtubule Dynamics by EB1 Photo-Dissociation. Nature Cell Biology. 20(3): 1504. PMC5826794. PDF

Woroniuk A, Porter, A., White, G., Newman, D.T., Diamontopoulou, Z., Waring, T., Rooney, C., Strathdee, D., Marston, D.J., Hahn, K.M., Sansom, o.J., Zech, T., and Malliri, A. (2018). STEF/TIAM2-mediated Rac1 activity at the nuclear envelope regulates the perinuclear actin cap. Nature Communications. 2(9):1. PMC5974301. PDF

Yan C, Wang, F., Peng, Y., Williams, C.R., Jenkins, B., Wildonger, J., Kim, H.J., Perr, J.B., Vaughan, J.C., Kern, M.E., Falvo, M. R., O’Brien III, E.T., Superfine, R., Tuthill, J.C., Xiang, y., Rogers, S.L., & Parrish, J.Z. (2018). Microtubule Acetylation Is Required for Mechanosensation in Drosophila. Cell Reports. 25(4):105-1065. PMC6248335 PDF

Yumerefendi H, Wang, H., Dickinson, D.J., Lerner, A.M., Malkus, P, Goldstein, B., Hahn, K., and Kuhlman, B. (2018). Light-dependent cytoplasmic recruitment enhances the dynamic range of a nuclear import photoswitch. ChemBioChem. 19(20): 1319-1325. PMC6013380. PDF

Dagliyan O., Karginov, A.V., Yagishita, S., Gale, M.E., Wang, H., DerMardirossian, C., Wells, C.M., Dokholyan, N.V., Kasai, H. and Hahn, K.M. (2017). Engineering Pak1 Allosteric Switches. ACS Synthetic Biology. 6(7):1257-62. PMC5562282. PDF

Hendrickx-Rodriguez S, Falvo, M.R., O’ Brien III, E.T., and Superfine, R. Effects of Opsonin Density and type on the Phagocytosis of Beads. Biophysical Journal 2017. p. 90A-1A. – Abstract

Herrington K.A., Trinh, A.L., Dang, C., O’Shaughnessy, E., Hahn, K.M., Gratton, E., Digman, M.A. and Sütterlin, C. (2017). Spatial analysis of Cdc42 activity reveals a role for plasma membrane-associated Cdc42 in centrosome regulation. Molecular Biology of the Cell. 28(15):2135-45. PMC5509425. PDF

Markovetz MR, Seim, I., Ramsey, K., Garbarine, I.C., Forest, G.M., Schultz, A., Stick, S., Boucher, R.C. Evaluating Mucus-Based Biomarkers of CF Airway Disease. Pediatric Pulmonology 2017. p. S258. – Abstract

Takano T., Wu, M., Nakamuta, S., Naoki, H., Ishizawa, N., Namba, T., Watanabe, T., Xu, C., Hamaguchi, T., Yura, Y., Amano, M., Hahn, K.M. and Kaibuchi, K. (2017). Discovery of long-range inhibitory signaling to ensure 0.3 single axon formation. Nature Communications. 8(1):33. PMC5484694. PDF

Taylor AB, Joannou, M.S., Watanabe, T., Hahn, K., and Chew, T.L. (2017). Perceptually accurate display of two greyscale images as a single colour image. Journal of Microscopy. 268(1):73-83. PMC5637524. PDF

Walton B. L., Hehmann, M., Skorczewski, T., Holle, L. A., Beckman, J. D., Cribb, J. A., Mooberry, M. J., Wufsus, A. R., Cooley, B. C., Homeister, J. W., Pawlinski, R., Falvo, M. R., Key, N. S., Fogelson, A. L., Neeves, K. B., and Wolberg, A. S. (2017). Elevated hematocrit enhances platelet accumulation following vascular injury. Blood. doi:746479. PMC5418635 PDF

Woodham E.F., Paul, N.R., Tyrrell, B., Spence, H.J., Swaminathan, K., Scribner, M.R., Giampazolias, E., Hedley, A., Clark, W., Kage, F., Marston, D.J., Hahn, K.M., Tait, S.W., Larue, L., Brakebusch, C.H., Insall, R.H. and Machesky, L.M. (2017). Coordination by Cdc42 of actin, contractility, and adhesion for melanoblast movement in mouse skin. Current Biology. 27(5):624-37. PMC5344686. PDF

Ye F., Yang, C., Kim, J., MacNevin, C.J., Hahn, K.M., Park, D., Ginsberg, M.H., and Kim, C. (2017). Epigallocatechin Gallate Has Pleiotropic Effects on Transmembrane Signaling by Altering the Embedding of Transmembrane Domains. The Journal of Biological Chemistry. 262(24):9858-64. PMC5473239. PDF

Blackmon, R.L., Sandhu, R., Chapman, B.S., Casbas-Hernandez, P., Tracy, J.B., Troester, M.A., and Oldenburg, A.L. (2016) Imaging Extracellular Matrix Remodeling In Vitro by Diffusion-Sensitive Optical Coherence Tomography. Biophysical Journal. 110(8):1858-68. PMC4850325. PDF

Burridge K, and Guilluy, C. (2016). Focal adhesions, stress fibers and mechanical tension. Experimental Cell Research. S0014-4827(15):30131-2. PMC4891215 PDF

Cribb JA, Osborne, L.D., Beicker, K., Psioda, M., Chen, J., O’Brien, E.T., Taylor II, R.M., Vicci, L., Hsiao, J.P., Shao, C., Falvo, M., Ibrahim, J.G., Wood, K.C., Blobe, G.C., & Superfine, R. (2016). An Automated High-throughput Array Microscope for Cancer Cell Mechanics. Scientific Reports. 6:27371. PMC4893602 PDF

Dagliyan, O., Tarnawski, M., Chu, P.H., Shirvanyants, D., Schlichting, I., Dokholyan, N.V., and Hahn, K.M. (2016) Engineering extrinsic disorder to control protein activity in living cells. Science. 354(6318):1441-1444. PMC5362825 PDF

Evans BA, Ronecker, J.C., Han, D.T., Glass, D.R., Train, T.L., and Deatsch, Alison, E. (2016). High-permeability functionalized silicone magnetic microspheres with low autofluorescence for biomedical applications. Elsevier. Epub 16 February 2016. doi:10.1016/j.msec.2016.01.094 PDF

Farzal Z, Walsh, J., Lopes de Rezende Barbosa, G., Zdanski, C.J., Davis, S. D., Superfine, R., Pimenta, L.A., Kimbell, J.S., and Drake, A.F. (2016). Volumetric nasal cavity analysis in children with unilateral and bilateral cleft lip and palate. Laryngoscope. 126(6):1475-1480. PMC4752420 PDF

Gentry L.R., Karginov A.V., Hahn K.M., Der C.J. (2016) Characterization of an Engineered Src Kinase to Study Src Signaling and Biology. Methods Molecular Biology. 1360: 157-167. PMC4621786. PDF

Givens, C., and Tzima, E. (2016) Endothelial Mechanosignaling: Does One Sensor Fit All? Antioxid Redox Signal. 25(7):373-388. PMC5011625 PDF

Lawrimore J, Aicher, J., Hahn, P., Fulp, A., Kompa, B., Vicci, L., Falvo, M., Taylor II, R., and Bloom, K. (2016). ChromoShake: a chromosome dynamics simulator reveals chromatin loops stiffen centromeric chromatin. Molecular Biology of the Cell. 27(1):153-66. PMC4694754. PDF

MacNevin CJ, Toutchkine, A., Marston, D.J., Hsu, C-W., Tsygankov, D., Li,L., Liu, B., Qi, T., Nguyen, D-V., and Hahn, K.M. (2016). Ratiometric imaging using a single dye enables simultaneous visualization of Rac1 and Cdc42 activation. Journal of the American Chemical Society. 138(8):2571-5. PMC4825053 PDF

Marjoram RJ, Guilluy, C., and Burridge, K. (2016). Using magnets and magnetic beads to dissect signaling pathways activated by mechanical tension applied to cells. Methods 94:19-26. PMC4761479. PDF

Methods and Systems to use actuated surface-attached posts for biofluid rheology, R. Superfine, R. Spero, B. Evans, B. Fiser, A. Shields, United States Patent 9,238,869 (February 1, 2016)

Quammen, C.W., Taylor II, R.M., Krajcevski, P., Mitran, S., Enquobahrie, A., Superfine, R., Davis, B., Davis, S., and Zdanski, C. (2016) The Virtual Pediatric Airways Workbench. Studies in health technology and informatics. 220:295-300.PMC5588666 PDF

Scott DW, Tolbert, C.E., & Burridge, K (2016). Tension on JAM-A activates RhoA via GEF-H1 and p115 RhoGEF. Molecular Biology of the Cell. 27(9):1420-30. PMC4850030. PDF

Spieser, D.L., Gagnon, Y.L., Chhetri, R.K., Oldenburg, A.L., and Johnsen, S. (2016) Examining the Effects of Chromatic Aberration, Object Distance, and Eye Shape on Image-Formation in the Mirror-Based Eyes of the Bay Scallop Argopecten irradians. Integrative and Comparative Biology. 56(5):796-808.PMC5886045 PDF

Wang, H., Vilela, M., Wink.er, A., Tarnawski, M., Schlichting, I., Yumerefendi, H., Kuhlman, B., Liu, R., Danuser, G., and Hahn, K.M. (2016) LOVTRAP: an optogenetic system for photoinduced protein dissociation. Nature Methods. 13(9):755-758. PMC5137947 PDF

Wang, H., and Hahn, K.M. (2016) LOVTRAP: A versatile method to control protein function with light. Current Protocols in Cell Biology. 73:21. PMC5137945. PDF

Bucay, I., O’Brien III, E.T., Wulfe, S., Superfine, R., Wolberg, A., Falvo, M., and Hudson, N. (2015). Physical Determinants of Fibrinolysis in Single Fibrin Fibers. PLoS One. DOI: 10.1371/journal.pone.011635. PMC4340865 PDF

Crassous JJ, Mihut, A.M., Mansson, L.K., and Schurtenberger, P. (2015). Anisotropic responsive microgels with tuneable shape and interactions. Nanoscale. 7(38):15971-82. PDF

Cribb, J., Osborne, L., Hsiao, J., Vicci, L., Meshram, A., O’Brien III, E.T., Spero, R., Taylor II, R., and Superfine, R. (2015). A high throughput array microscope for the mechanical characterization of biomaterials. AIP Review of Scientific Instruments 86(023711). PMC4344474 PDF

Du K, Zheng, S., Zhang, Q., Li, S., Gao, X., Wang, J., Jiang, L., and Liu, K. (2015). Pten Deletion Promotes Regrowth of Corticospinal Tract Axons 1 Year after Spinal Cord Injury. The Journal of Neuroscience. 35(26):9754-63. PDF

Fiser B, Shields, A., Falvo, M., and Superfine, R. (2015). Highly responsive core-shell microactuator arrays for use in viscous and viscoelastic fluids. Journal of Micromechanics and Microengineering 25(2). PMC4577244 PDF

Grube M, Cernava, T., Sho, J., Fuchs, S., Aschenbrenner, I., Lassek, C., Wegner, U., Becher, D., Riedel, K., Sensen, C.W., and Berg, G. (2015). Exploring functional contexts of symbiotic sustain within lichen-associated bacteria by comparative omics. The ISME Journal. 9(2):412-24. PMC4303634. PMC4303634 PDF

Guilluy C, Burridge, K. (2015). Nuclear mechanotransduction: forcing the nucleus to respond. Nucleus. 6(1):19-22. PMC4615784. PMC4615784 PDF

Judith, R., Fisher, J., Spero, R., Fiser, B., Turner, A., Oberhardt, B., Taylor II, R., Falvo, M, Superfine, R., and Lab Chip (2015). “Micro-elastometry on whole blood clots using actuated surface-attached posts (ASAPs).” Lab Chip 15(5): 1385-1393. PMC4545258 PDF

Lawrimore J, Vasquez, P.A., Falvo, M., Taylor II, R., Vicci, L., Yeh, E., Forest M.G., and Bloom, K. (2015). DNA loops generate intracentromere tension in mitosis. The Journal of Cell Biology. 210(4):553-64. PMC4539978 PDF

Li, S., He, Q., Wang, H., Tang, X., Ho, K.W., Gao, X., Zhang, Q., Shen, Y., Cheung, A., Wong, F., Ip, N.Y., Jiang, L., Yung, W.H., and Liu, K. (2015). Injured adult retinal axons with Pten and Socs3 co-deletion reform active synapses with suprachiasmatic neurons. Neurobiology of Disease. 73:366-76. PDF

Mair l, Weinberg, I., Nacev, A., Urdaneta, M., Stepanov, P., Hilaman, R., Himelfarb, S., and Superfine, R. (2015). Analysis of driven nanorod transport through a biopolymer matrix. Journal of Magnetism and Magnetic Materials. 380:295-298 PMC4321758 PDF

Murray E, Sayyar, S., Thompson, B.C., Gorkin III, R., Officer, D.L., and Wallace, G.G. (2015). A bio-friendly, green route to processable, biocompatible graphene/polymer composites. RSC Advances. 5(56):45284-90. PDF

Sears, P., Blackmon, R., Lynch, S., Superfine, R., Oldenburg, A., and Ostrowski, L.E. (2015) Mucociliary transport in circular cultures of primary human airway epithelial cells: effect of ciliary beat frequency and mucus concentration. Pediatric Pulmonary. 50:234-235. Abstract

Shao C, Zhong, A., Cribb, J., Osborne, L.D., O’Brien III, E.T., Superfine, R., Mayer-Patel, K., Taylor II, R.M. (2015). Analysis-preserving video microscopy compression via correlation and mathematical morphology. Microscopy Research and Technique. PMC4715596. PDF

Short B (2015). The tension mounts at centromeric loops. The Journal of Cell Biology. 210(4):523. PDF

Vicory J, Couture, H.D., Thomas, N.E., Borland, D., Marron, J.S., Woosley, J., and Niethammer, M. (2015). Appearance normalization of histology slides. Computerized Medical Imaging and Graphics. 43:89-98. PMC4769595. PMC4769595 PDF

Wen B, Campbell, K.R., Cox, B.L., Eliceiri, K.W., Superfine, R., and Campagnola, P.J. Multi-view second-harmonic generation imaging of mouse tail tendon via reflective micro-prisms. In: Letters O, editor. July 2015: Optical Society America 2015. p. 3201-4. PMC4979975 PDF

Yi JJ, Berrios, J., Newbern, J.M., Snider, W.D., Philpot, B.D., Hahn, K.M., and Zylka, M.J. (2015). An Autism-Linked Mutation Disables Phosphorylation Control of UBE3A. Cell. 162(4):795-807. PMC4537845. PMC4537845 PDF

Yumerefendi H, Dickinson, D.J., Wang, H., Zimmerman, S.P., Bear, J.E., Goldstein, B., Hahn, K., and Kuhlman, B. (2015). Control of Protein Activity and Cell Fate Specification via Light-Mediated Nuclear Translocation. plOs oNE. 10(6):E0128443. PMC4471001. PMC4471001 PDF

Zdanski C, Davis, S., Hong, Y., Miao, D., Quammen, C., Mitran, S., Davis, B., Niethammer, M., Kimbll, J., Pitkin, E., Fine, J., Fordham, L., Vaughn, B., and Superfine, R. (2015). Quantitative assessment of the upper airway in infants and children with subglottic stenosis. Laryngoscope. PMC5257243 PDF

Bays J, Peng, X., Tolbert, E., Guilluy, C., Angell, A., Pany, Y., Superfine, R., Burridge, K., & Demali, A (2014). Vinculin phosphorylation differentially regulates mechanotransduction at cell-cell and cell-matrix adhesions. Journal of Cell Biology. 205(2):251-63. PMC4003237. PDF

Beicker KN, O’Brien III, E.T., Falvo, M., & Superfine, R. (2014). Viewing Nuclear Deformation with Sideways Microscopy. Biophysical Society 106(2):42A-43A. (abstract)

Bloom KS (2014). Centromeric heterochromatin: the primordial segregation machine. Annual Review of Genetics. (48):457-84. PMC4245377. PDF

Chhetri, R., K., Blackmon, R., Wu, W.-C., Hill, D.B., button, B., Casbas-Hernandez, P., Troester, M., Tracy, J.B., and Oldenburg, A.L. (2014). “Probing biological nanotopology via diffusion of weakly constrained plasmonic nanorods with optical coherence tomography.” Proceedings of the National Academy of Sciences 111(41): E42897-E44297. PMC4205670. PDF

Collins, C, Osborne, L., Guilluy C., Chen, Z., O’Brien III, E., Reader, J., Burridge, K., Superfine, R., & Tzima, E. (2014) Haemodynamic and extracellular matrix cues regulate the mechanical phenotype and stiffness of aortic endothelial cells. Nature Communications 5:3984. doi:10.1038/ncomms4984 PMC4068264 PDF

Davidson Ward S., Amin, R., Arens, R., Chen, Z., Davis, S., Gutmark, E., Superfine, R., Wong, B., Zdanski, C., and Khoo, M. (2014). Pediatric Sleep-Related Breathing Disorders: Advanced in imaging and computational modeling. IEEE Pulse. (September/October):33-9. PDF

Fisher J, & Kleckner, N. (2014). Magnetic force micropiston: an integrated force/microfluidic device for the application of compressive forces in a confined environment. The Review of Scientific Instruments. 85(2):023704. PMC3970836 PDF

Guilluy, C, Osborne, L. D., Van Landeghem, L., Sharek, L., Superfine, R., Garcia-Mata, R., and Burridge, K. (2014) Isolated nuclei adapt to force and reveal a mechanotransduction pathway in the nucleus. Nature Cell Biology. 16(4):376-381. PMC4085695 PDF

Hill D, Vasques, P., Mellnik, J., McKinley, S., Vose, A., Mu, F., Henderson, A., Donaldson, S, Alexis, N., Boucher, R., & Forest, M. (2014). A biophysical basis for mucus solids concentration as a candidate biomarker for airways disease. PloS one. 9(2):e87681. PMC3928107. PDF

Hong Y, Davis, B., Marron, J.S., Kwitt, R., Sing, N., Kimbell, J.S., Pitkin, E., Superfine, R., Davis, S.D., Zdanski, C.J., & Niethammer, M. (2014). Statistical atlas construction via weighted functional boxplots. Medical Image Analysis. 18(4):684-98. PMC4029168. PDF

Hong Y, Singh, N., Kwitt, R., Vasconcelos, N., and Niethammer, M., (2014). Geodesic Regression on the Grassmannian. Proceedings of the European Conference on Computer Vision. (Refereed, 15 pages) PDF

Hong Y, Gao Y, Niethammer M, Bouix S. 2014. Depth-Based Shape Analysis. Proceedings of the International Conference on Medical Image Computing and Computer Assisted Intervention (MICCAI). (Refereed, 8 pages). Student Best Paper Award. PDF

Hong Y, Singh, N., Kwitt, R., and Niethammer, M. (2014). Time-warped Geodesic Regression. Proceedings of the International Conference on Medical Image Computing and Computer Assisted Intervention.(Refereed, 8 pages) PDF

Huang L, Hsiao, J.P., Poierza, C. Taylor II, R., and Lord, S. (2014). Does Topology Drive Fiber Polymerization? Biochemistry. 53(49):7824-34. PMC4270379. PDF

Lee, W., Leddy, H.A., Chen, Y., Lee, S.H., Zelenski, N.A., McNulty, A.L., Wu, J., Bieker, K., Coles, J., Zauscher, S., Sachs, J., Guilak, F., and Liedtke, W. (2014). “Synergy between Piezo1 and Piezo2 Channels Confers High-Strain Mechanosensitivity to Articular Cartilage.” Proceedings of the National Academy of Sciences 111(47): E5114-E5522. PMC4250098. PDF

Lessey-Morillon, E, Osborne, L., Monaghan-Benson, E., Guilluy, C., O’Brien III, E.T., Superfine, R., & Burridge, K. (2014) The RhoA GEF, LARG, mediates ICAM-1-dependent mechanotransduction in endothelial cells to stimulate transendothelial migration. The Journal of Immunology. 192(7):3390-3398. PMC3991232 PDF

Mair LO, and Superfine, R. (2014). Single Particle Tracking Reveals Biphasic Transport During Nanorod Magnetophoresis Through Extracellular Matrix. Soft Matter. 10(23):4118-25. PMC4265469 PDF

Marjoram, R.J., Lessey, E.C., & Burridge, K. (2014). Regulation of RhoA activity by adhesion molecules and mechanotransduction. Current Molecular Medicine. 14(2):199-208. PMC3929014. PDF

Mellnik J, Vasquez, P.A., McKinley, S.A., Witten, J., Hill, D.B., Forest, M.G. (2014). Micro-heterogeneity metrics for diffusion in soft matter. Soft Matter. 10(39):7781-96. PMC4186960. PDF

Osborne, L. D., Li, G.Z., How, T., O’Brien, E.T. 3rd, Blobe G.C., Superfine, R., and Mythreye, K. (2014). “TGF-β regulates LARG and GEF-H1 during EMT to impact stiffening response to force and cell invasion.” Molecular Biology of the Cell 25(22): 3528-3540. PMC4230614. PDF

Osborne LD, Cribb, J., Vicci, L., O’Brien III E.T., Hsiao, J., Taylor, R.M. II, & Superfine, R. (2014). Array Microscope for High Throughput Stiffness Characterization of Cancer Biology. Biophysical Society 106(2):619A-619A. (abstract)

Shan L, Zach, C., Charles, C., and Niethammer, M., (2014). Automatic Atlas-based Three-label Cartilage Segmentation from MR Knee Images. Medical Image Analysis. 18 (7): 1233-46. PDF

Sing N, Couture, H.D., Marron, J.S., Perou, C., & Niethammer, M. Topological Descriptors of Histology Images. Machine Learning in Medical Imaging: Springer International Publishing 2014. p. 231-239. Book Chapter. PDF

Sing N, and Niethammer, M., (2014). Splines for Diffeomorphic Image Regression. Proceedings of the International Conference on Medical Image Computing and Computer Assisted Intervention. 17: 121-9. PDF

Taylor II R, Shao, C., Zhong, A., and Mayer-Patel, K., inventor METHODS, SYSTEMS, AND COMPUTER READABLE MEDIA FOR COMPRESSING VIDEO IMAGES. U.S. Provisional patent application 2014.

Taylor II R, and Harter, J., (2014). Random Per-Element Luminance Modulation for Improved Visual Tracking. IEEE computer graphics and applications. 34(6):83-87. PDF

Thompson M, Tolbert, C., Shen, K., Kota, P., Palmer, S., Plevock, K., Orlova, A., Galkin, V., Burridge, K., Egelman, E., Dokholyan, N., Superfine, R., & Campbell, S. (2014). Identification of an Actin Binding Surface on Vinculin that Mediates Mechanical Cell and Focal Adhesion Properties. Structure. 22(5):697-706. PMC4039106 PDF

Tolbert CE, Thompson, P.M., Superfine, R., Burridge, K., Campbell, S.L. (2014). Phosphorylation at Y1065 in Vinculin Mediates Actin Bundling, Cell Spreading, and Mechanical Responses to Force Biochemistry. 53(34):5526-36. PMC4151700. PDF

Waldon, S., Thompson, P., Hahn, P., Taylor II, R. (2014). “SketchBio: A Scientist’s 3D Interface for Molecular Modeling and Animation.” BMC Bioinformatics Journal 15(334). PMC4287593 PDF

Wijesundara K, Zdanski, C., Kimbell, J., Price, H., Iftimia, N., and Oldenburg, A.L. (2014). Quantitative upper airway endoscopy with swept-source anatomical optical coherence tomography. Biomedical Optics Express. 5(3):788-799. PMC3959831. PDF

Zhao Q, Pizer, S., Niethammer, M., and Rsoenman, I., (2014). Geometric-Feature-Based Spectral Graph Matching in Pharyngeal Surface Registration. Proceedings of the International Conference on Medical Image Computing and Computer Assisted Intervention. (Refereed, 8 pages). PMC4382356 PDF

Note: The Computer Science community uses conference proceedings as the principal mode of dissemination, with acceptance rates often less than 30%. They therefore have the status of refereed journal articles.

New TRD2. Biomolecular Imaging Tools references: We report the recent references of TRD PI Prof. Klaus Hahn. This work has not been supported by CISMM proper over the past year, but we report here for convenience of access and information for collaboration opportunities.

Helassa N, Garnett JP, Farrant M, Khan F, Pickup JC, Hahn KM, MacNevin CJ, Tarran R, Baines DL. A novel fluorescent sensor protein for detecting changes in airway surface liquid glucose concentration. Biochem J. 2014 Sep 15. [Epub ahead of print] PMID: 25220254

Weitzman M, Hahn KM.Optogenetic approaches to cell migration and beyond. Curr Opin Cell Biol. 2014 Oct30C:112-120. doi: 10.1016/j.ceb.2014.08.004. Epub 2014 Sep 15. PMID: 25216352

Chu PH, Tsygankov D, Berginski ME, Dagliyan O, Gomez SM, Elston TC, Karginov AV, Hahn KM.Engineered kinase activation reveals unique morphodynamic phenotypes and associated trafficking for Src family isoforms. Proc Natl Acad Sci U S A. 2014 Aug 26111(34):12420-5. doi: 10.1073/pnas.1404487111. PMID: 25118278 [PubMed – in process]

Tsygankov D, Chu PH, Chen H, Elston TC, Hahn KM. User-friendly tools for quantifying the dynamics of cellular morphology and intracellular protein clusters. Methods Cell Biol. 2014123:409-27. doi: 10.1016/B978-0-12-420138-5.00022-7. PMID: 24974040 [PubMed – in process]

Yi JJ, Wang H, Vilela M, Danuser G, Hahn KM Manipulation of Endogenous Kinase Activity in Living Cells Using Photoswitchable Inhibitory Peptides. ACS Synth Biol. 2014 Jun 13. PMID: 24905630

Karginov AV, Hahn KM, Deiters A. Optochemical activation of kinase function in live cells.Methods Mol Biol. 20141148:31-43. doi: 10.1007/978-1-4939-0470-9_3. PMID: 24718793

Dissecting motility signaling through activation of specific Src-effector complexes. Nat Chem Biol. 2014 Apr10(4):286-90. doi: 10.1038/nchembio.1477. Epub 2014 Mar 9. Erratum in: Nat Chem Biol. 2014 Aug10(8):692. PMID: 24609359

Hinde E, Yokomori K, Gaus K, Hahn KM, Gratton E. Fluctuation-based imaging of nuclear Rac1 activation by protein oligomerisation. Sci Rep. 2014 Feb 274:4219. doi: 10.1038/srep04219. PMID: 24573109

Tsygankov D, Bilancia CG, Vitriol EA, Hahn KM, Peifer M, Elston TC. CellGeo: a computational platform for the analysis of shape changes in cells with complex geometries. J Cell Biol. 2014 Feb 3204(3):443-60. doi: 10.1083/jcb.201306067. PMID: 24493591

Morrow PK, Broxson AC, Munsell MF, Basen-Enquist K, Rosenblum CK, Schover LR, Nguyen LH, Hsu L, Castillo L, Hahn KM, Litton JK, Kwiatkowski DN, Hortobagyi GN. Effect of age and race on quality of life in young breast cancer survivors. Clin Breast Cancer. 2014 Apr14(2):e21-31. doi: 10.1016/j.clbc.2013.10.003. Epub 2013 Oct 25. PMID: 24461458

Khalil BD, Hanna S, Saykali BA, El-Sitt S, Nasrallah A, Marston D, El-Sabban M, Hahn KM, Symons M, El-Sibai M The regulation of RhoA at focal adhesions by StarD13 is important for astrocytoma cell motility. Exp Cell Res. 2014 Feb 15321(2):109-22. doi: 10.1016/j.yexcr.2013.11.023. Epub 2013 Dec 10. PMID: 24333506

Cai D, Chen SC, Prasad M, He L, Wang X, Choesmel-Cadamuro V, Sawyer JK, Danuser G, Montell DJ. Mechanical feedback through E-cadherin promotes direction sensing during collective cell migration. Cell. 2014 May 22157(5):1146-59. doi: 10.1016/j.cell.2014.03.045. PMID: 24855950

Martin K, Vilela M, Jeon NL, Danuser G, Pertz O. A growth factor-induced, spatially organizing cytoskeletal module enables rapid and persistent fibroblast migration. Dev Cell. 2014 Sep 2930(6):701-16. doi: 10.1016/j.devcel.2014.07.022. PMID: 25268172

Burridge K, & Wittchen, E. (2013). The tension mounts: Stress fibers as force-generating mechanotransducers. Journal of Cell Biology. 200(1):9-19. PMC3542796. PDF

Calloway, H., Kimbell, J., Davis, S., Retsch-Bogart, G., Pitkin, E., Abode, K., & Superfine, R. (2013). Comparison of endoscopic versus 3D CT derived airway measurements. Laryngoscope.123(9):2136-2141 PDF

Cao, T., Jojic, V., Modla, S., Powell, D., Czymmek, K., & Niethammer, M. (2013). Robust Multimodal Dictionary Learning. . Medical Image Computing and Computer Assisted Intervention Society. Book Chapter PDF

Cao T, Zach, C., Modla, S., Powell, D., Czymmek, K., and Niethammer, M. (2014). Multi-modal registration for correlative microscopy using image analogies. Medical Image Analysis. 18(6):914-26. PMC4062605. PDF

Collins, C., &Tzima, E. (2013). RhoA goes GLOBAL. Small GTPases.4(2):123-126. PMC3747253 PDF

Cribb, J., Vasquez, P., Moore, P., Norris, S., Shah, S., Forest, M., Superfine, R. (2013). Nonlinear signatures in active microbead rheology of entangled polymer solutions. Journal of Rheology.57(4):1247-1264. PMC3920902 PMC3920902/PDF

Csapo, I, Davis, B., Shi, Y., Sanchez, M., Styner, M., Niethammer, M. (2013) Longitudinal image registration with temporally-dependent image similarity measure. IEEE Transactions on Medical Imaging. 32(10):1939-1951. PMC3947578 PMC3947578 /PDF

Dutta, S., Horita, D., Hantgan, R., & Guthold, M. (2013). PROBING αIIbβ3: LIGAND INTERACTIONS BY DYNAMIC FORCE SPECTROSCOPY AND SURFACE PLASMON RESONANCE. Nano LIFE.03(01) PMC3788690 PMC3788690/PDF

Fisher J, Bourniguel, A., Witz, G., Weiner, B., Prentiss, M., & Kleckner, N. (2013). Four-Dimensional Imaging of E. coli Nucleoid Organization and Dynamics in Living Cells. Cell. 153(4):882-95. PMC3670778 PDF

Funkhouser 3rd, K. W., Niethammer, M., Carson, J., Burns, K., Knowles, M., Leigh, M., Zariwala, M., & Funkhouser Jr, W.K. (2013). A New Tool Improves Diagnostic Test Performance for Transmission EM Evaluation of Axonemal Dynein Arms. Ultrastructural Pathology. PMC3990650 PDF

Haase, J., Mishra, P., Stephens, A., Haggerty, R., Quammen, C., Taylor II, R., Yeh, E., Basrai, M., & Bloom, K., (2013) A 3D map of the yeast kinetochore reveals the presence of core and accessory centromere specific histone. Current Biology. 23(19):1936-1944. PMC3796065 PDF

Hanna, S., , Krishnan, B., Bailey, S., Moschos, S., Kuan, P., Shimamura, T., Osborne, L., Siegel, M., Duncan, L., O’Brien III, E., Superfine, R., Miller, C., Simon, M., Wong. K., and Kim, W. (2013). HIF1α and HIF2α independently activate SRC to promote melanoma metastases. Journal of Clinical Investigation. 123(5):2978-2093. PMC3635738 PMC3635738/PDF

Herschlaq, G., Garcia, G.J., Button, B., Tarran, R., Lindley, B., Reingardt, B., Elston, T.C., & Forest, G.M. (2013). A mechanochemical model for auto-regulation of lung airway surface layer volume. Journal of Theoretical Biology. (325)42-51. PMC3631568 PDF

Hong, Y., Davis, B., Marron, J., Kwitt, R., & Niethammer, M. (2013). Weighted Functional Boxplot with Application to Statistical Atlas Construction. Medical Image Computing and Computer Assisted Intervention Society. 16(Pt 3):584-591. Book Chapter PDF

Hong, Y., Niethammer, M., Andruejol, J., Kimbell, J., Pitkin, E., Superfine, R., Davis, S., Zdanski, C., and Davis, B. (2013). A Pediatric Airway Atlas and its Application in Subglottic Stenosis. International Symposium on Biomedical Imaging: From Nano to Macro. PDF

Horowitz, E., Rahman, S., Bower, B., Dismuke, D., Falvo, M., Griffith, J., Harvey, S., and Asokan, A. (2013). Biophysical and ultrastructural characterization of adeno-associated viral capsid uncoating and genome release. Journal of Virology.87(6):2994-3002. PMC3592113 PMC3592113/PDF

Hudson, N., Ding, F., Bucay, I., O’Brien III, E.T., Gorkun, O., Superfine, R., Lord, S., Dokholyan, N., & Falvo, M. (2013). Submillisecond elastic recoil reveals molecular origins of fibrin fiber mechanics. Biophysical Journal. 104(12):2671-2680. PMC3686331 PDF

Jones, G, Blonder, R., Gardner, G., Alve, V., Falvo, M., & Chevrier, J. (2013) Nanotechnology and nanoscale science: Challenges educating the next generation. International Journal of Science Education. online. “Not NIH Supported”

Kohli L, Whitton, M., and Brooks, F. (2013). Redirected Touching: Training and Adaptation in Warped Virtual Spaced. Proceedings of 2013 IEEE Symposium on 3D User Interfaces 3DUI.79-86. PDF

Mitran, S. (2013). Continuum-kinetic-microscopic model of lung clearance due to core-annular fluid entrainment. Journal of Computational Physics. (244):193-211.PMC3665523 PDF

Niethammer, M., and Zach, C. (2013). Segmentation with Area Constraints. Medical Image Analysis.17(1):101-112. PMC3656501 PMC3656501/PDF

Oldenburg, A., Chhetri, R., Cooper, J., Wu, W., Troeste, M., & Tracy, J. (2013) Motility-, autocorrelation-, and polarization-sensitive optical coherence tomography discriminates cells and gold nanorods within 3D tissue cultures. Optics Letters. 38(15):2923-2926. PMC3856705 PDF

Qian, X., Song, J.M., Melkamu, T., Upadhyaya, P., & Kassie, F. (2013) Chemoprevention of lung tumorigenesis by intranasally administered diindolylmethane in A/J mice. Carcinogenesis. 34(4):841-849. PMC3616664 PDF

Samson T, van Buul, J., Droon, J., Welch, C., Bakker, E., Matlung, H., van den Berg, T., Sharek, L., Doerschuk, C., Hahn, K., & Burridge, K. (2013). The Guanine-Nucleotide Exchange Factor SGEF Plays a Crucial Role in the Formation of Atherosclerosis. PloS one. 8(1):55202. PMC3555862. PDF

Stephens, A., Haggerty, R., Vasquez, P., Vicci, L., Snider, C., Shih, F., Quammen, C., Mullins, C., Haase, J., Taylor II, R., Verdaasdonk, J., Falvo, M., Jin, Y. Forest, G., & Bloom, K. (2013). Pericentric Chromatin Loops Function as a Nonlinear Spring in Mitotic Force Balance. Journal of Cell Biology.200(6):757-772. PMC3601350 PMC3601350/PDF

Stephens A, Snider, C., Haase, J., Haggerty, R., Vasquez, P., Forest, M., & Bloom, K. (2013). Individual pericentromeres display coordinated motion and stretching in the yeast spindle. Journal of Cell Biology. 203(3):407-16. PMC3824013 PDF

Stephens A, Quammen, C., Chang, B., Haase, J., Taylor, R., & Bloom, K. (2013). The spatial segregation of pericentric cohesin and condensin in the mitotic spindle. Molecular Biology of the Cell. 24(24):3909-19. PMC3861086 PDF

Tolbert C, Burridge, K., & Campbelle, S. (2013). Vinculin regulation of F-actin bundle formation: What does it mean for the cell? Cell Adhesion & Migration. 7(2):219-25. PMC3954036. PDF

Tretter, T., Jones, M., & Falvo, M. (2013). Nanoscience for All: Strategies for Teaching Nanoscience to Undergraduate Freshmen Science and Non-Science Majors. Journal of Nano Education.5(1):1-9. “Not NIH Supported’

Varshney, R.K., Song, C., Saxena, R.K., Azam, S., Yu, S., Sharpe, A.G., Cannon, S., Baek, J., Rosen, B.D., Tar’an, B., Millan, T., Zhang, X., Ramsay, L.D., Iwata, A., Wang, Y., Nelson, W., Farmer, A.D., Gaur, P.M., Soderlund, C., Penmetsa, R.V., Xu, C., Bharti, A.K., He, W., Winter, P., Zhao, S., Hane, J.K., Carrasquilla-Garcia, N., Condie, J.A., Upadhyaya, H.D., Luo, M.C., Thudi, M., Gowda, C.L., Singh, N.P., Lichtenzveig, J., Gali, K.K., Rubino, J., Nadarajan, N., Dolezel, J., Bansal, K.C., Xu, X., Edwards, D., Zhang, G., Kahl, G., Gil, J., Sing, K.B., Datta, S.K., Jackson, S.A., Wang, J., & Cook, D.R. (2013) Draft genome sequence of chickpea (Cicer arietinum) provides a resource for trait improvement. National Biotechnology. 31(3):240-246. PDF

Vasquez, P., Jin, Y., Yuong, K., Hill, D.B., & Forest, G. (2013). A new twist on Stokes’ second problem: Partial penetration of nonlinearity in sheared viscoelastic layers. Journal of Non-Newtonian Fluid Mechanics.196(0):36-50. PDF

Verdaasdonk J, Vasquez, P., Barry, R., Barry, T., Goodwin, S., Forest, M., & Bloom, K. (2013). Centromere Tethering Confines Chromosome Domains. Molecular Cell. 52(6):819-31. PMC3877211 PDF

Verdaasdonk J, Stephens, A., Haase, J., and Bloom K. (2013). Bending the Rules: Widefield Microscopy and the Abbe Limit of Resolution Journal of Cellular Physiology. 229(2):132-8. PMC4076117. PDF

Wijesundara, K., Iftimia, N., & Oldenburg, A. (2013). Design of a swept-source, anatomical OCT system for pediatric bronchoscopy. Proceedings of SPIE. 8571. doi: 10.1117/12.2004226. PMC3864962 PDF

Alabi, O., Wu, X., Harter, J., Phadke, M., Pinto L., Petersen, H. Bass, S., Keifer, M., Zhong, S., Healey, C., and Taylor II, R. Comparative Visualization of Ensembles Using Ensemble Surface Slicing. Proceedings of SPIE Visualization and Data Analysis 2012 January 2012 Burlingame, California.8294:82940U. PMC3614370 PMC3614370/PDF

Button, B., Cai, L.H., Ehre, C., Kesimer, M., Hill, D.B., Sheehan, J., Boucher, R., and Rubinstein, M. (2012). A Periciliary Brush Promotes the Lung Health by Separating the Mucus Layer from Airway Epithelia. Science.337(6097):937-941. PMC3633213 PMC3633213/PDF

Camassa, R., Forest, M.G., Lee, L., Ogrosky, H.R., Olander, J. (2012). Ring waves as a mass transport mechanism in air-driven core-annular flows. Physical review. E, Statistical, nonlinear, and soft matter physics. 86(6 Pt 2) PDF

Cao, T., Zach, C., Modla, S., Powell, D., Czymmek, K., and Niethammer, M. (2012). Registration for Correlative Microscopy Using Image Analogies. Biomedical Image Registration (WBIR).7359:296-306 NIHMS596525 PDF

Chhetri, R., Phillips, Z., Torester, M., & Oldenburg, A. (2012) Longitudinal study of mammary epithelial and fibroblast co-cultures using optical coherence tomography reveals morphological hallmarks of pre-malignancy. PLoS One. 7(11):e49148. PMC3495770 PMC3495770/PDF

Collins, C., Guilluy, C., Welch, C., O’Brien, T., Hahn, K., Superfine, R., Burridge, K., and Tzima, E. (2012). Localized tensional forces on PECAM-1 elicit a global mechanotransduction response via the integrin-RhoA pathway. Current Biology.22(22):2087-2094. PMC3681294 PDF

Csapo, I., Davis, B., Shi, Y., Sanchez, M., Styner, M., Niethammer, M. (2012). Longitudinal Image Registration with Non-uniform Appearance Change. Medical Image Computing and Computer-Assisted Intervention (MICCAI). 15(Pt 3):280-288. PMC3584325 PMC3584325/PDF

Didier G, McKinley, S., Hill, D.B., & Fricks, J. (2012). Statistical challenges in microrheology. Journal of Time Series Analysis. 33(5):724-43. PDF

Evans, B., Fiser, B., Prins, W., Rapp, D., Shields, A., Glass, D., and Superfine, R. (2012). A Highly Tunable Silicone-Based Magnetic Elastomer with Nanoscale Homogeneity. Journal of Magnetism and Magnetic Materials.324(4):501-507. PMC3241051 PMC3241051/PDF

Grooman, B., Fujiwara, I., Otey, C., Upadhyaya, A. (2012) Morphology and viscoelasticity of actin networks formed with the mutually interacting crosslinkers: palladin and alpha-actinin. PLoS One. 7(8):e42773. PMC3420904 PMC3420904/PDF

Haase, J., Stephens, A., Verdaasdonk, J., Yeh, E., and Bloom, K. (2012). Bub1 Kinase and Sgo1 Modulate Pericentric Chromatin in Response to Altered Microtubule Dynamics. Current Biology.22(6):471-481.PMC3311747 PMC3311747/PDF

Harter J, Wu, X., Alabi, O., Phadke, M., Pinto, L., Dougherty, D., Petersen, H., Bass, S., & Taylor II, R. Increasing the Perceptual Salience of Relationships in Parallel Coordinate Plots. Proceedings of SPIE Visualization and Data Analysis January 2012 Burlingame, California.8294:T1 – T12.PMC3491905 PMC3491905/PDF

Hong, Y., Joshi, S., Sanchez, M., Styner, M., Niethammer, M. (2012). Metamorphic Geodesic Regression. Medical Image Computing and Computer-Assisted Intervention (MICCAI).15(Pt 3):197-205. PMC3584322 PMC3584322/PDF

Hong, Y., Shi, Y., Styner, M., Sanchez, M., and Niethammer, M. (2012). Simple Geodesic Regression for Image Time-Series. Biomedical Image Registration (WBIR).7359:11-20. NIHMS596520 PDF

Jerald J, Whitton, M., and Brooks, F. (2012). Scene-Motion Thresholds During Head Yaw for Immersive Virtual Environments. ACM Transactions on Applied Perception. 9(1). PMC4334481 PDF

Kallemov, B., Miller, G.H., Mitran, S., and Trebotich, D. (2012). Calculation of viscoelastic bead-rod flow mediated by a homogenised kinetic scale with holonomic constraints. Molecular Simulation.38(10):786-792

Kesimer, M., Ehre, C., Burns, K.A., Davis C.W., Sheehan, J.K., Pickles, R.J. (2012). Molecular organization of the mucins and glycocalyx underlying mucus transport over mucosal surfaces of the airways. Mucosal Immunology.6(2):379-392. PMC3637662 PMC3637662/PDF

Kohli L, Whitton, M., and Brooks, F. (2012). Redirected touching: The effect of warping space on task performance. 3D User Interfaces (3DUI), IEEE Xplore Digital Library.105-12. PDF

Lam Hui, K., Wang, C., Grooman, B., Wayt, J., & Upadhyaya, A. (2012) Membrane dynamics correlate with formation of signaling clusters during cell spreading. Biophysical journal. 102(7):1524-1533. PMC 3318117 PMC3318117/PDF

Lee, H., Foskey, M., Niethammer, M., Krajcevski, P., & Lin, M. (2012). Simulation-Based Joint Estimation of Body Deformation and Elasticity Parameters for Medical Image Analysis. IEEE Transactions on Medical Imaging. 31(11):2156-2168. NIHMS555789 PDF

Lessey, E., guilluy, C., and Burridge, K. (2012). From Mechanical Force to RhoA Activation. Biochemistry.51(38):7420-7432.PMC3567302 PMC3567302/PDF

Lewek, M., Feasel, J., Wentz, E., Brooks Jr, F., and Whitton, M. (2012). Use of visual and proprioceptive feedback to improve gait speed and spatiotemporal symmetry following chronic stroke: a case series. Physical Therapy.92(5):748-756. PMC3345339 PMC3345339/PDF

Lindley, B., Forest, M.G., Smith, B., Mitran, S., and Hill, D. (2012). Spatial stress and strain distributions of viscoelastic layers in oscillatory shear. Mathematics and Computers in Simulation.82(7):1249-1257.PMC3338131 PMC3338131/PDF

Liu, C., Miller, H., Orlowski, G., Hang, H., Upadhyaya, A., & Song, W. (2012) Actin reorganization is required for the formation of polarized B cell receptor signalosomes in response to both soluble and membrane-associated antigens. Journal of Immunology. 188(7):3237-3246. PMC3312033 PMC3312033/PDF

Liu, C., Miller, H., Sharma, S., Beaven, A., Upadhyaya, A., & Song, W. (2012) Analyzing actin dynamics during the activation of the B cell receptor in live B cells. Biochemical and Biophysical Research Communications. 427(1):202-206. PMC3499104 PMC3499104/PDF

Miedema, J., Marron, J. S., Niethammer, M., Boland, D., Woosley, J., Coposky, J., Wei, S., Reisner, H., and Thomas, N. E. (2012). Image and statistical analysis of melanocytic histology. Histopathology.61(3):436-444.PMC3425719 PMC3425719/PDF

Oldenburg, A., Chhetri, R., Hill, D.B., & Button, B. (2012). Monitoring airway mucus flow and ciliary activity with optical coherence tomography.3(9):1978-1992.PMC3447542 PMC3447542/PDF

Peck T, Fuchs, H, and Whitton, M. (2012). The Design and Evaluation of a large-Scale Real-Walking Locomotion Interface. IEEE Transactions on Visualization and Computer Graphics. 18(7):1053-67. PMC4091684 PDF

Park, R., Ping, L., Song, J., Hong, S.Y., Choi, T.Y., Choi, J.R., Gorkun, O.V., and Lord, S.T. (2012). Fibrinogen residue γAla341 is necessary for calcium binding and ‘A-a’ interactions. Journal of Thrombosis and Haemostasis.107(5):875-883

Phadke, M., Pinto, L., Alabi, F., Harter, J., Taylor II, R., Wu, X., Petersen, H., Bass, S., and Healey, C. Exploring Ensemble Visualization. Proceedings of SPIE Visualization and Data Analysis 2012 January 2012 Burlingame, California.8294:(82940B). PMC3278305 PMC3278305/PDF

Roh-Johnson, M., Shemer, G., Higgins, C.D., McClellan, J.H., Werts, A.D., Tulu, U.S., Gao, L., Betzig, E., Kiehart, D.P., and Goldstein, B. (2012). Triggering a Cell Shape Change by Exploiting Pre-Existing Actomyosin Contractions. Science.335(6073):1232-1235.PMC3298882 PMC3298882

Taylor II, R., and Bloom, K.?Intersecting Art and Computer Graphics? in Visual Strategies by Felice Frankel and Angela H. DePace: ISBN 978-0-300-17644 2012. p. 102-107. Book Chapter

Cai, L.H., Panyukov, S., and Rubinstein, M. (2011) Mobility of Nonsticky Nanoparticles in Polymer Liquids. Macromolecules. 44(19):7853-7863 PDF

Caplan, J., Niethammer, M., Taylor II R., and Czymmek, K. (2011). The Power of Correlative Microscopy: Multi-modal, Multi-scale, Multi-dimensional. Current Opinion in Structural Biology.21(5):686-693. PMC3189301 PMC3189301/PDF

Eastwood, B., Mair, L., and Taylor II, R. (2011). A Structured Illumination Method for Microscope Stage Tracking. International Conference on Image Processing, Computer Vision, and Pattern Recognition. 1:201-207. NIHMS325150 “not excepted by PMC” PDF

Evans B., Superfine R. (2011). Design Considerations for Magnetically Actuated Cilia. Biomimetic Based Applications (p. 473-498). Anne George (Ed.), Rijeka, Croatia: InTech. Book Chapter PDF

Feasel, J., Whitton, M., Kassler, L., Brooks, F., and Lewek, M. The Integrated Virtual Environment Rehabilitation Treadmill System. IEEE Transactions on Neural Systems & Rehabilitation Engineering 2011.19(3):290-297. PDF

Finan, J.D., Leddy, H.A., & Guilak, F. (2011) Osmotic stress alters chromatin condensation and nucleocytoplasmic transport. Biochemical and Biophysical Research Communications. 408(2):230-235. PMC3104296 PMC3104296/PDF

Fronczek, D., Quammen, C., Wang, H., Kisker, C., Superfine, R., Taylor II, R., Erie, D., Tessmer, I. (2011). High Accuracy Fiona-AFM Hybrid Imaging. Ultramicroscopy.111(5):350-355. PMC3179268 PMC3179268/PDF

Gibbs-Flournoy, E., Bromberg, P., Hofer, T., Samet, J., & Zucker, R. (2011) Darkfield-Confocal Microscopy Detection of Nanoscale Particle Internalization by Human Lung Cells. Particle and Fibre Toxicology. 8:2. PMC3033333 PMC3033333/PDF

Guilluy C., Swaminathan, V., Garcia-Mata R., O’Brien, E., Superfine, R., Burridge K. (2011). The Rho GEFs LARG and GEF-H1 regulate the mechanical response to force on integrins. Nature Cell Biology. 2011 Jun 13(6):724-729. PMC3107386 PMC3107386/PDF

Guilluy, C., Garcia,-Mata, R., & Burridge, K. (2011) Rho protein crosstalk: another social network? Trends in Cell Biology. 21(12):718-726. PMC3221770 PMC3221770/PDF

Lewis, J., Hembree, W., Furman, B., Tippets, L., Cattel, D., Huebner, J., Little, D., & DeFrate, L. (2011) Acute joint pathology and synovial inflammation is associated with increased intra-articular fracture severity in the mouse knee. Osteoarthritis and Cartilage. 19(7):864-873. PMC3312469 PMC3312469/PDF

Liu, C., Miller, H., Hui, K.L., Grooman, B., Bolland, S., Upadhyaya, A., & Song, W. (2011) A balance of Bruton’s tyrosine kinase and SHIP activation regulates B cell receptor cluster formation by controlling actin remodeling. Journal of Immunology. 187(1):230-239. PMC3119787 PMC3119787/PDF

Lozoya O., Wauthier E., Turner R., Barbier C., Prestwich G., Guilak F., Superfine R., Lubkin S., Reid L. Regulation of Hepatic Stem/Progenitor Phenotype by Microenvironment Stiffness in Hydrogel Models of the Human Liver Stem Cell Niche. Biomaterials. 32(30):7389-7402. PMC3157321. PMC3157321/PDF

Mair, L. O., Evans, B., Hall, A. R., Carpenter, J., Shields, A., Ford, K., Millard, M., & Superfine, R. (2011). Highly Controllable Near-Surface Swimming of Magnetic Janus Nanorods: Application to Payload Capture and Manipulation. Journal of Physics D: Applied Physics. 44(125001). NIHMS337284 PDF

Merkel, T., Jones, S., Herlihy, K., Kersey, F., Shields, A., Napier, M., Luft, J., Wu, H., Zamboni, W., Wang, A., Bear, J., & DeSimone, J. (2011). Using Mechanobiological Mimicry of Red Blood Cells to Extend Circulation Times of Hydrogel Microparticles. Proceedings of National Academy of Science.108(2):586-591. PMC3021010 PMC3021010/PDF

Mitran, S., & Young, J. (2011). Multiscale Computation of Cytoskeletal Mechanics During Blebbing. Cellular and Biomolecular Mechanics and Mechanobiology.345-371 PDF

Niethammer, M., Hart, G., Pace, D., Vespa, P., Irimia, A., Van Horn, J., and Aylward, S. Geometric Metamorphosis. Conference on Medical image Computing and Computer Assisted Intervention 2011.14:639-646. PMID21995083 PDF

Niethammer, M., Huang, Y., Vialard, F., (2011) Geodesic Regression for Image Time-Series, Conference on Medical Image Computing and Computer Assisted Intervention (MICCAI). 14(Pt 2):655-662. PMID21995085 PDF

Pace, D., Enquobahrie, A., Yang, H., Aylward, S., and Niethammer, M. Deformable Image Registration of Sliding Organs Using Anisotropic Diffusive Regularization. The International Symposium on Biomedical Imaging 2011:407-413.PMC3141338 PMC3141338/PDF

Peck, T., Fuchs, H., & Whitton, M. An Evaluation of Navigational Ability Comparing Redirected Free Exploration with Distractors to Walking-in-Place and Joystick Locomotion Interfaces. Proceedings of IEEE Virtual Reality March 19-23, 2011 Singapore:55-62.PMC3268068 PMC3268068/PDF

Ping, L. Huang, L., Cardinali, B., Profumo, A., Gorkun, O.V., & Lord, S.T., (2011) Substitution of the human aC region with the analogous chicken domain generates a fibrinogen with severely impaired lateral aggregation: Fibrin monomers assemble into protofibrils but protofibrils do not assemble into fibers. Biochemistry. 50(42(:9066-9075. PMC3203410 PMC3203410

Quammen, C. & Taylor II, R. (2011). Grid voxelization with partial volume effects in VTK. VTK Journal. March. NIHMS325155 “not excepted by PMC” PDF

Shen, K., Tolbert, C.E., Guilluy, C., Swaminathan, V.S., Berginski, M.E., Burridge, K., Superfine, R., and Campbell, S.L. (2011). The vinculin C-terminal hairpin mediates F-actin bundle formation, focal adhesion, and cell mechanical properties. Journal of Biological Chemistry. 286(52):45103-45115. PMC3247952 PMC3247952/PDF

Skarbez, R., Kotranza, A., Brooks, F., Lok, B., and Whitton, M. An Initial Exploration of Conversational Errors as a Novel Method for Evaluating Virtual Human Experiences. Proceedings of IEEE Virtual Reality 2011 March 2011 Singapore:243-244 PDF

Spero, R., Sircar, R., Shubert, R., Taylor II, R., Wolberg, A., Superfine, R. (2011). Nanoparticle Diffusion Measures Bulk Clot Permeability. Biophysical Journal. 101(1-8):943-950. PMC317506 PMC3175063/PDF

Stephens, A., Haase, J., Vicci, L., Taylor II, R., and Bloom, K. (2011). Cohesin, condensin, and the intramolecular centromere loop together generate the mitotic chromatin spring. Journal of Cell Biology.193(7):1167-1180. PMC3216333 PMC3216333/PDF

Swaminathan, V., Mythreye, K., O’Brien, E., Berchuck, A., Blobe, G., Superfine, R. (2011). Mechanical stiffness grades metastatic potential in patient tumor cells and in cancer cell lines. Cancer Research 71(15):5075-5080. PMC3220953 PMC3220953/PDF

Yemolenko, I.S., Alexander, F., Gorkun, O.V., Lishko, V.K., Lord, S.T., Ros, R., & Ugarova, T.P. (2011) The Role of the alpha C Domains in the Formation of Nonadhesive Fibrinogen Matrices. Blood. 118(21):538

Young, J., & Mitran, S. (2011). A Continuum-Microscopic Algorithm for Modeling Fibrous, Heterogeneous Media with Dynamic Microstructures. SIAM Multiscale Modeling and Simulation.9(241-256) PDF

Campbell, R., Aleman, M., Gray, L., Falvo, M., & Wolberg, A. (2010). Flow Profoundly Influences Fibrin Network Sturcture: Implications for Fibrin Formation and Clot Stability in Hemostasis. Journal of Thrombosis and Haemostasis. 104(6):1281-1284. PMC3236083 PMC3236083/PDF

Carlisle, R. C., Sparks, E.A., Der Loughian, C., & Guthold, M. (2010). Strength and Failure of Fibrin Fiber Branchpoints. Journal of Thrombosis and Haemostasis.8(5):1135-1138.PMC3013622 PMC3013622/PDF

Chehetri, R., Carpenter, J., Superfine, R., Randell, S., & Oldenburg, A. (2010). Magnetomotive optical coherence elastography for relating lung structure and function in cystic fibrosis. Proceedings of SPIE. Vol. 7554. PMC3268340 PMC3268340/PDF

Cribb, J., Meehan, T., Shah, S., Skinner, K. & Superfine, R. (2010). Cylinders vs. Spheres: Biofluid Shear Thinning in Driven Nanoparticle Transport. Annals of Biomedical Engineering. 38(11):3311-3322. PMC3858002 PMC3858002/PDF

Falvo, M., Gorkun, O., & Lord. S. (2010). The molecular origins of the mechanical properties of fibrin. Biophysical Chemistry. Nov152(1-3):15-20. PMC2975759 PMC2975759/PDF

Feasel, J., Whitton, M., Kassler, L., Brooks, F., and Lewek, M. The Integrated Virtual Environment Rehabilitation Treadmill System. IEEE Transactions on Neural Systems & Rehabilitation Engineering.19:290-297. PDF

Feng, D., Kwock, L., Lee, Y., & Taylor II, R. M. (2010). Linked Exploratory Visualizations for Uncertain MR Spectroscopy Data. Proceedings of the Conference on Visualization and Data Analysis (SPIE).7530:12 pages.PMC2997734 PMC2997734/PDF

Feng, D., Lee, Y., Kwock, L., & Taylor II, R. (2010). Matching Visual Saliency to Confidence in Plots of Uncertain Data. IEEE Transactions on Visualization and Computer Graphics (Proceedings Visualization/Information Visualization). 16(6):980-989. PMC3179257 PMC3179257/PDF

Hackney, Z., Mair, L., Skinner, K., Washburn, S. (2010). Photoconductive and polarization properties of individual CdTe nanowires. Materials Letters.64(18) 2016-2018. PMC2920430 PMC2920430/PDF

Hall, A. R., An, L., Liu, J., Vicci, L., Falvo, M. R., Superfine, R., Washburn, S. (2010). Experimental Measurement of Single-Wall Carbon Nanotube Torsional Properties. Physical Review Letters.96(25):256102. PMC3274556 PMC3274556/PDF

Hart, G., Shi, Y., Zhu, H., Sanchez, M., Styner, M., and Niethammer, M. (2010). DTI Longitudinal Atlas Building as an Average of Growth Models. Medical Image Computing and Computer Assisted Intervention, Workshop on Spatio-Temporal Image Analysis for Longitudinal and Time-Series Image Data. NIHMS337251 PDF

Hill, D., Swaminathan, V., Estes, A., Cribb, J., O’Brien, E., Davis, C., Boucher, R., & Superfine, R. (2010). Force Generation and Dynamics of Individual Cilia under External Loading. Biophysical Journal 6:98(1): 57-66. PMC2800978 PMC2800978/PDF

Houser, J., Hudson, N., Ping, L., O’Brien, E., Superfine, R., Lord, S., & Falvo, M. (2010). Evidence that αC region is origin of low modulus, high extensibility, and strain stiffening in fibrin fibers. Biophysical Journal. 99(9):3038-3047. PMC2965937 PMC2965937/PDF

Hudson, N., Houser, J., O’Brien, E., Taylor, R., Superfine, R., Lord, S., & Falvo, M. (2010). Stiffening of Individual Fibrin Fibers Equitably Distributes Strain and Strengthens Networks. Biophysical Journal 98(8): 1632-1640. PMC2856168 PMC2856168/PDF

Kassler, L., Feasel, J., Lewek, M., Brooks, F., & Whitton, M. Matching Actual Treadmill Walking Speed and Visually Perceived Walking Speed in a Projection Virtual Environment. Proceedings of the 7th ACM Symposium on Applied Perception in Graphics and Visualization LosAngeles CA:161-161 PDF

Liu, X., Davis, B., Niethammer, M., Pizer, S., Mageras, G. (2010). Prediction-driven respiratory motion atlas formation for 4D image-guided radiation therapy in lung. MICCAI, International Workshop on Pulmonary Image Analysis. NIHMS337269 (not accepted by PMC) PDF

Liu, W., Carlisle, R. C., Sparks, E. A., & Guthold, M. (2010). The mechanical properties of single fibrin fibers. Journal of Thrombosis and Haemostasis.8(5):1030-1036.PMC3010862 PMC3010862/PDF

Liu, Y., Lin, X., Upadhyaya, M., Song, Q., & Chen, K. (2010) Intraductal papillary mucinous neoplasms of the pancreas: correlation of helical CT features with pathologic findings. European Journal of Radiology. 76(2):222-227 PDF

Niethammer, M., Borland, D., Marron, S., Woosley, J., and Thomas, N. (2010). Appearance Normalization of Histology Slides. Medical Image Computing and Computer Assisted Intervention, Workshop on Machine Learning in Medical Imaging.6357:58-66. NIHMS337285 PDF

Nunes, J., Herlihy, K. P., Mair, L. O., Superfine, R., & DeSimone, J. M. (2010). Multifunctional shape and size specific magneto-polymer composite particles. Nano Letters.10(4):1113-1119.PMC3357060 PMC3357060/PDF

Peck, T., Fuchs, H., & Whitton, M. (2010). Improved Redirection with Distractors: A Large Scale Real Walking Locomotion System and its Effect on Navigation in Virtual Environments. Proceedings of IEEE Virtual Reality 2010 (Waltham, MA March 2010), 35-38. PDF

Quammen, C. & Taylor II, R. (2010). “Adapting the ITK Registration Framework to fit Parametric Image Models,” Kitware Source. (16):9-12. PMC3322640 PMC3322640/PDF

Shields, A. R., Fiser, B. L., Evans, B.A., Falvo, M.R., Washburn, S., & Superfine, R. Biomimetic cilia arrays generate simultaneous pumping and mixing regimes. Proceedings of the National Academy of Sciences September 7, 2010.107:15670-15675.PMC2936597 PMC2936597/PDF

Taylor II, R. M., Jerald, J., VanderKnyff, C., Wendt, J., Borland, D., Marshburn, D., Sherman, W. R., Whitton, M. C. (2010). Lessons about Virtual-Environment Software Systems from 20 years of VE building. Presence 19(2): 163-178. PMC2887604 PMC2887604/PDF

Wendt, J., Whitton, M. C., & Brooks, F. B. (2010). GUD WIP: Gait-Understanding-Driven Walking-In-Place.Proceedings of IEEE Virtual Reality 2010 (Waltham, MA March 2010), 51-58. NIHMS599421 PDF

Young, J., & Mitran, S. (2010). A Numerical Model of Cellular Blebbing. A Volume-Conserving, Fluid-Structure Interaction Model of the Entire Cell. Journal of Biomechanics. (43):210-220. PMC2813352 PMC2813352/PDF

Campbell, R. A., Overmyer, K. A., Selzman, C. H., Sheridan, B. C., & Wolberg, A. S. (2009). Contributions of extravascular and intravascular cells to fibrin network formation, structure, and stability. Blood.114(23):4886-4896.PMC2786294 PMC2786294/PDF

Carlisle, C. R., Coulais, C., Namboothiry, M., Carroll, D. L., Hantgan, R. R., & Guthold, M. (2009). The mechanical properties of individual, electrospun fibrinogen fibers. Biomaterials.30(6):1205-1213.PMC3012557 PMC3012557/PDF

Chourasia, A., & Taylor II, R. IEEE Visualization 2008 Design Contest. IEEE CG&A Visualization Viewpoints May/June 2009.29:pp. 86-87

Darling, E. M., P. E. Pritchett, Evans, B., Superfine, R., Zausher, S., & Guilak, F. (2009). Mechanical Properties and Gene Expression of Chondrocytes on Micropatterned Substrates Following Dedifferentiation in Monolayer. Cellular and Molecular Bioengineering 2(3): 395-404. PMC2898162 PMC2898162/PDF

Dedeugd, C., Wankhede, M., & Sorg, B. S. (2009). Multimodal optical imaging of microvessel network convective oxygen transport dynamics. Applied Optics.48(10):D187-197. PDF

Feng, D., Kwock, L., Lee, Y. Z., & Taylor, R. M. (2009). Evaluation of Glyph-based Multivariate Volume Visualization Techniques. Proceedings of the 6th Symposium on Applied Perception in Graphics and Visualization 2009: 61-68. PMC3087293 PMC3087293/PDF

Fisher, J. K., Ballenger, M., O’Brien, E. T., Haase, J., Superfine, R., & Bloom, K. (2009). DNA relaxation dynamics as a probe for the intracellular environment. Proceedings of the National Academy of Sciences 106(23): 9250-9255. PMC2695107 PMC2695107/PDF

Fricks, J., Yao, L. X., Elston, T. C., & Forest, M. G. (2009). Time-Domain Methods for Diffusive Transport in Soft Matter. SIAM Journal on Applied Mathematics.69(5):1277-1308 PDF

Gerardin, E., Chetelat, G., Chupin, M., Cuingnet, R., Desgranges, B., Kim, H. S., Niethammer, M., Dubois, B., Lehericy, S., Garnero, L., Eustache, F., Colliot, O., Alzheimer’s Dis Neuroimaging, I. (2009). Multidimensional classification of hippocampal shape features discriminates Alzheimer’s disease and mild cognitive impairment from normal aging. Neuroimage.47(4):1476-1486.PMC3001345 PMC3001345/PDF

Ghosh, S., Dutta, S., Gomes, E., Carroll, D., D’Agostino Jr., R., Olson, J., Guthold, M., & Gmeiner, W. H. (2009). Increased heating efficiency and selective thermal ablation of malignant tissue with DNA-encased multiwalled carbon nanotubes. ACS Nano.3(9):2667-2673.PMC2748720 PMC2748720/PDF

Grubb, B. R., Rogers, T. D., Boucher, R. C., & Ostrowski, L. E. (2009). Ion transport across CF and normal murine olfactory and ciliated epithelium. American Journal of Physiology – Cell Physiology.296(6):C1301-C1309.PMC2692423 PMC2692423/PDF

Hinczewski, M., Schlagberger, X., Rubinstein, M., Krichevsky, O., Netz, R. R. (2009). End-Monomer Dynamics in Semiflexible Polymers. Macromolecules.42(3):860-875.PMC3043606 PMC3043606/PDF

Jerald, J., Steinicke, F., & Whitton, W. Scene-Motion Thresholds Correlate with Angular Head Motions for Immersive Virtual Environments. IEEE Advances in Computer-Human Interaction 2009:69-75 PDF

Jerald, J., & Whitton, M. (2009). Relating Scene-Motion Thresholds to Latency Thresholds for Head-Mounted Displays. Proceedings of IEEE Virtual Reality Lafayette, LA. March 211-218. PMC3095496 PMC3095496/PDF

Jerald, J. Scene Instability During Head Turn. Proceedings of IEEE VR Workshop on Perceptual Illusions in Virtual Environments 2009 Lafayette, LA PDF

Kaplan, E., Min, J. -Y., Ke, Q., Chen, Y., Niethammer, M., Rana, J. S., Malek, S., Verheugt, F. W. A., & Morgan, J. P. (2009). Calcium and cyclic nucleotides affect TNF-alfa-induced stem cell migration. Biochemical and Biophysical Recearch Communications.382:241-246.PMC2941773 PMC2941773

Kohli, L. Exploiting Perceptual Illusions to Enhance Passive Haptics. IEEE VR Workshop on Perceptual Illusions in Virtual Environments 2009 Lafayette, LA PDF

Levitt, J. J., Styner, M., Niethammer, M., Bouix, S., Koo, M. S., Voglmaier, M. M., Dickey, C. C., Niznikiewicz, M. A., Kikinis, R., McCarley, R. W., Shenton, M. E. (2009). Shape abnormalities of caudate nucleus in schizotypal personality disorder. Schizophrenia Research.110(1-3):127-139.PMC2756791 PMC2756791/PDF

Lindley, B., Howell, E. L., Smith, B. D., Rubinstein, G. J., Forest, M. G., Mitran, S. M., Hill, D. B., & Superfine, R. (2009). Stress communication and filtering of viscoelastic layers in oscillatory shear. Journal of Non-Newtonian Fluid Mechanics 156(1-2): 112-120. PDF

Livraghi, A., Grubb, B. R., Hudson, E. J., Wilkinson, K. J., Sheehan, J. K., Mall, M. A., O’Neal, W. K., Boucher, R. C., & Randell, S. H. (2009). Airway and lung pathology due to mucosal surface dehydration in -epithelial Na+ channel-overexpressing mice: role of TNF- and IL-4R signaling, influence of neonatal development, and limited efficacy of glucocorticoid treatment. The Journal of immunology. 182(7):4357-4367. PMC2659461 PMC2659461/PDF

Macenko, M., Niethammer, M., Marron, J. S., Borland, D., Woosley, J. T., Guan, X., Schmitt, C., & Thomas, N. E. (2009). A method for normalizing histology slides for quantitiative analysis. International Symposium on Biomedical Imaging.1107-1110

Mair, L., Ford, K., Alam, R., Kole, R., Fisher, M., & Superfine, R. (2009). Size-Uniform 200 nm Particles: Fabrication and Application to Magnetofection. Journal of Biomedical Nanotechnology 5: 182-191. PMC2818021 PMC2818021/PDF

Mair, L., Skinner, K., Donley, C.L., Superfine, R. (2009). Electrodeposited Au-CdTe-Au nanowires: solution-based control over Cd/Te stoichiometry. Electrochemical Society Transactions(19(3)): 99-109.

McKinley, S., Yao, L., & Forest, M. (2009). Transient anomalous diffusion of tracer particles in soft matter. Journal of Rheology. (53):1487-1506 PDF

Niethammer, M., Zach, C., Melonakos, J., Tannenbaum, A. (2009). Near-tubular fiber bundle segmentation for diffusion weighted imaging: Segmentation through frame reorientation. Neuroimage.45(1):S123-S132.PMC2774769 PMC2774769/PDF

Peck, T. M., Fuchs, H., & Whitton, M. C. (2009). Evaluation of Reorientation Techniques and Distractors for Walking in Large Virtual Environments. Transactions on Visualization and Computer Graphics 15(3): 383-394. PMC2844119 PMC2844119/PDF

Peck, T., Fuchs, H., & Whitton, M. C. (2009). Improved Redirection with Distractors: A Large Scale Real Walking Locomotion System and its Effect on Navigation in Virtual Environments. Virtual Reality Conference (VR) IEEE.35-38 PDF

Quammen, C., Feng, D., & Taylor II, R. M. Performance of 3D deconvolution algorithms on multi-core and many-core architectures. UNC-Chapel Hill Department of Computer Science Technical Report.TR-09-001 PDF

Reuter, M., Wolter, F. E., Shenton, M., Niethammer, M. (2009). Laplace-Beltrami eigenvalues and topological features of eigenfunctions for statistical shape analysis. Computer-Aided Design.41(10):739-755.PMC2753296 PMC2753296/PDF

Taylor II, R. M., Robinett, W., Chi, V. L., Brooks Jr., F.P., Wright, W. V., Williams, R. S., Snyder, R. J., Chen, J., Okimoto, S., Llopis-Artime, N., Falvo, M., Paulson, S., Thiansathaporn, P., Glick, D., Washburn, S., Superfine, R., Jen, D., Parente, P., Robbins, J., Weigle, C., Burette, A., Weinberg, R., Varadhan, G., & Erie, D. Computer-Integrated Systems for Microscopy and Manipulation. IEEE VisWeek 2009 Discovery Exhibition 2009:2 pages PDF

Voineskos, A. N., O’Donnell, L. J., Lobaugh, N. J., Markant, D., Ameis, S. H., Niethammer, M., Mulsant, B. H., Pollock, B. G., Kennedy, J. L., Westin, C. F., Shenton, M. E. (2009). Quantitative examination of a novel clustering method using magnetic resonance diffusion tensor tractography. Neuroimage.45(2):370-376.PMC2646811 PMC2646811/PDF

Wirtz, D. (2009) Particle-tracking microrheology of living cells: principles and applications. Annual review of Biophysics. 38:301-326 PDF

Zach, C., Niethammer, M., & Frahm, J. M. (2009). Continuous maximal flows and Wulff Shapes: Applications to MRFs. Proceedings of the Conference on Computer Vision and Pattern Recognition (CVPR).1911-1918 PDF

Zach, C., Shan, L., & Niethammer, M. (2009). Globally optimal Finsler active contours. Proceedings of the Pattern Recognition Symposium of the German Association for Pattern Recognition (DAGM).5748:552-561 PDF

Zhang L, B. B., Gabriel SE, Burkett S, Yan Y, Skiadopoulos MH, Dang YL, Vogel LN, McKay T, Mengos A, Boucher RC, Collins PL, Pickles RJ. (2009). CFTR Delivery to 25% of Surface Epithelial Cells Restores Normal Rates of Mucus Transport to Human Cystic Fibrosis Airway Epithelium. PLOS Biology. (7).PMC2705187 PMC2705187/PDF

Button, B., Boucher, R. C. (2008). Role of mechanical stress in regulating airway surface hydration and mucus clearance rates. Respir Physiol Neurobiol.163(1-3):189-201. PMC2645865

Cakici, S.S. Sezerman, U., & Balcisoy, S. (2008) DockPro: A VR-Based Tool for Protein-Protein Docking ProblemS. The international Journal of Virtual Reality. 8(Issue2-2009/4):19-23.

Campbell, R.A., Overmyer, K.A., Bagnell, C.R., & Wolberg, A.S. (2008) Cellular procoagulant activity dictates clot structure and stability as a function of distance from the cell surface. Arteriosclerosis, Thrombosis, and Vascular Biology. 28(12):2247-2254. PMC2773697
publication PMC2773697

Davis, C. W., & Lazarowski, E. (2008). Coupling of airway ciliary activity and mucin secretion to mechanical stresses by purinergic signaling. Respiratory Physiology Neurobiology. (163):1-3. PMC2583098

Davis, C.W., & Dickey, B.F. (2008) Regulated airway goblet cell mucin secretion. Annual Review of Physiology. 70:487-512.
publication 17988208

Desai, K.V., Bishop, T.G., Vicci, L., O’Brien, E.T., Taylor II, R., & Superfine, R. (2008) Agnostic particle tracking for three-dimensional motion of cellular granules and membrane-tethered bead dynamics. Biophysical Journal. 94(6): p. 2374-84. PMC2257905

Desprat, N., Supatto, W., Pouille, P.A., Beaurepaire, E., & Farge, E. (2008) Tissue deformation modulates twist expression to determine anterior midgut differentiation in Drosophila embryos. Developmental Cell. 15(3):470-477.

Falvo, M.R., Millard, D., O’Brien, E.T., Superfine, R., & Lord, S.T. (2008) Length of tandem repeats in fibrin’s alphaC region correlates with fiber extensibility. Journal of Thrombosis and Haemostasis. 2008. PMC2655637

Feasel, J., M.C. Whitton, and J.D. Wendt. LLCM-WIP: Low Latency, Continuous -Motion Walking-In-Place. Proceedings of IEEE Symposium on 3D User Interfaces. 2008. 97-104.

Feng, D., Y. Lee, L. Kwock, and Taylor R.M. Ii. Multivariate Scalar Volume Visualization for Relationship and Value Estimation. Transactions on Visualization and Computer Graphics. 2008.

Hohenegger, C., Forest, M. (2008). Two-bead microrheology: modeling protocols. Physical review. E, Statistical, nonlinear, and soft matter physics.78(3 Pt 1):031501.PMC2692253

Huang, B., Jones, S.A., Brandenburg, B., & Zhuang, X. (2008) Whole-cell 3D STORM reveals interactions between cellular structures with nanometer-scale resolution. Nature Methods. 5(12)1047-1052. PMC2596623
publication PMC2596623

Jerald, J., T.M. Peck, F. Steinicke, and M. Whitton. Sensitivity to Scene Motion for Phases of Head Yaws. Proceedings of Applied Perception in Graphics and Visualization. 2008.

Kharlampieva, E., Ankner, J.F., Rubinstein, M., & Sukhishvili, S.A. (2008) pH-induced release of polyanions from multilayer films. Physical Review Letters. 100(12):128303

Kreda, S., Boucher, R.C., Lazarowski, E. (2008). Nucleotide release and airway epithelial physiology. Physiology News. (71):19-22

Lan, Y., Elston, T.C., & Papoian, G.A. (2008) Elimination of fast variables in chemical langevin equations. The Journal of Chemical Physics. 129(21):214115. PMC2674792

Lloyd, B., Govindaraju, N., Quammen, C., Molnar, S., Manocha, D. (2008) Logarithmic Perspective Shadow Maps. ACM Transactions of Graphics. 27(4)

Mihalik, J.P., L. Kohli, and M.C. Whitton. Do the physical characteristics of a virtual reality device contraindicate its use for balance assessment? Journal of Sport Rehabilitation. 2008. 17(1): p. 38-49.

Mitran, S., M.G. Forest, B. Lindley, L. Yao, and D.B. Hill. Extensions of the Ferry shear wave model for active linear and nonlinear microrheology. Non-Newtonian Fluid Mechanics. 2008. PMC2790219

Nie, Z., Fava, D., Rubinstein, M., & Kumacheva, E. (2008) “Supermolecular” assembly of gold nanorods end-terminated with plymer “pom-poms”: effect of pom-pom structure on the association modes. Journal of American Chemical Society. 130(11):3683-3689.

O’Brien, E.T., 3rd, M.R. Falvo, D. Millard, B. Eastwood, R.M. Taylor, 2nd, and R. Superfine. Ultrathin self-assembled fibrin sheets. Proc Natl Acad Sci U S A. 2008. 105(49): p. 19438-43. PMC2614779

O’Brien, E.T., J. Cribb, D. Marshburn, R.M. Taylor, 2nd, and R. Superfine. Chapter 16: Magnetic manipulation for force measurements in cell biology. Methods Cell Biol. 2008. 89: p. 433-50.

Peck, T.M., M.C. Whitton, and H. Fuchs, Evaluation of Reorientation Techniques for Walking in Large Virtual Environments, in Proceedings of IEEE Virtual Reality. 2008: Reno, NV. p. 121-127.

Quammen, C.W. and R.M. Taylor II. cover image on Current Biology. 2008.

Quammen, C.W., richardson, A.C., Haase, J., Harrison, B.D., Taylor, R.M., & Bloom, K.S. (2008) FluoroSim: A Visual Problem-Solving Environment for Fluorescence Microscopy, in proceedings of the Eurographics Workshop on Visual Computing for Biomedicine, Delft, Netherlands, Oct. 6-7, 2008, pp. 151–158. PMC2860625

Shusharina, N.P., & Rubinstein, M. (2008 Concentration regimes in solutions of polyelectrolyte stars. Macromolecules. 41(1):203-217.

Sonnenwald, D.H., M.C. Whitton, and K. Maclaughlin, Evaluation of a scientific collaboratory system: Investigating a collaboratory’s potential before deployment, in Science on the Internet, G. Olson, A. Zimmerman, and N. Bos, Editors. 2008, MIT Press: Boston.

Spero, R.C., L. Vicci, J. Cribb, D. Bober, V. Swaminathan, E.T. O’Brien, S.L. Rogers, and R. Superfine. High throughput system for magnetic manipulation of cells, polymers, and biomaterials, polymers, and biomaterials. Rev Sci Instrum. 2008. 79(8): p. 083707. PMC2748383

Spero, R., & Taylor II, R. (2008) Scalar Potential Topography Can Simplify Interpretation of 2D Vector Fields. UNC Computer Science Technical Report.

Spero, R. C., Wolberg, A., Lord, S., & Superfine, R. (2008). “High Throughput Screening of Fibrin Clots: Transport and Mechanics Measured by Microbeads.” Blood Abstracts.

Superfine, R., Swaminathan, V., O’Brien, E.T., Boucher, R., Button, B., & Estes, A. Stall Force and Response of Lung Cilia. American Physical Society, 2008 APS March Meeting. 2008.

Taylor, A. C. a. R. (2009). IEEE Visualization 2008 Design Contest. IEEE CG&A Visualization Viewpoints. Vol. 29, No. 3: pp. 86-87.

Taylor, R. C. S. a. R. M. (2008). “Scalar Potential Topography Can Simplify Interpretation of 2D Vector Fields.” UNC Computer Science Technical Report #RT08-008.

Taylor, R. M., 2nd (2008). Haptics for Scientific Visualization. Haptic Rendering: Foundations, Algorithms, and Applications. M. Lin and M. Otaduy, A. K. Peters LTD.

Visnapuu, M.L., Fazio, T., Wind, S., & Greene, E.C. (2008) Parallel arrays of geometric nanowells for assembling curtains of DNA with controlled lateral dispersion. Langmuir. 24(19):11293-11299. PMC2748852

Whitton, M.C. and S. Razzaque, Locomotion, in HCI Beyond the GUI: Design for Haptic, Speech, Olfactory and Other Nontraditional Interfaces, P. Kortum, Editor. 2008, Morgan Kaufmann: Burlington, MA. p. 107-146.

Whitton, M. and F. Brooks, Evaluating VE Component Technologies, in VE Components and Training Technologies, D. Nicholson, J. Cohn, and D. Schmorrow, Editors. in press, Praeger Security International: Westport, CN.

Whitton, M. and J. D. Wendt (2008). Modeling and Rendering. Virtual Environments for Training and Education: Developments for the Military and Beyond. D. Nicholson, D. Schmorrow and J. Cohen. Westport, CN, Praeger Security International. 2: 15-20.

Whitton, M. and Loftin, R.B., Section Perspective: Virtual Environment Component Technologies, in VE Components and Training Technologies, D. Nicholson, J. Cohn, and D. Schmorrow, Editors. in press, Praeger Security International: Westport, CN.

Wong, O.K., Guthold, M., Erie, D.A., & Gelles, J. (2008) Interconvertible Lac Repressor-DNA Loops Revealed by Single-Molecule Experiments. PLoS Biology. 6(9):e232. PMC2553838

Zach, C, Gallup, D., Frahm, J. M., Niethammer, M. Fast global labeling for real-time stereo using multiple plane sweeps. Vision, Modeling, and Visualization Workshop 2008.

Zuo, P., Picher, M., Okada, S. F., Lazarowski, E. R., Button, B., Boucher, R. C., Elston, T. C. (2008). Mathematical model of nucleotide regulation on airway epithelia. Implications for airway homeostasis. Journal of Biological Chemistry. 283(39):26805-26819. PMC2546543

Abdullah, L.H. and C.W. Davis. Regulation of airway goblet cell mucin secretion by tyrosine phosphorylation signaling pathways. Am J Physiol Lung Cell Mol Physiol. 2007. 293(3): p. L591-9.

Borland, D. and M.R. Taylor, 2nd. Rainbow color map (still) considered harmful. IEEE Comput Graph Appl. 2007. 27(2): p. 14-7.

Boucher, R.C. Evidence for airway surface dehydration as the initiating event in CF airway disease. J Intern Med. 2007. 261(1): p. 5-16.

Boucher, R.C. Airway surface dehydration in cystic fibrosis: pathogenesis and therapy. Annu Rev Med. 2007. 58: p. 157-70.

Boucher, R.C. Cystic fibrosis: a disease of vulnerability to airway surface dehydration. Trends Mol Med. 2007. 13(6): p. 231-40.

Boucher, R.C. Evidence for airway surface dehydration as the initiating event in CF airway disease. J Intern Med. 2007. 261(1): p. 5-16.

Bouzarth, E.L., A. Brooks, R. Camassa, H. Jing, T.J. Leiterman, R.M. McLaughlin, R. Superfine, J. Toledo, and L. Vicci. Epicyclic orbits in a viscous fluid about a precessing rod: theory and experiments at the micro- and macro-scales. Phys Rev E Stat Nonlin Soft Matter Phys. 2007. 76(1 Pt 2): p. 016313.

Burette, A., D. Feng, D. Marshburn, D. Jen, R. Weinberg, and R.M.T. II. ToolBox: Stepping into the third dimension. Journal of Neuroscience. 2007. 27: p. 12757 – 12760.

Burns, E., S. Razzaque, M. Whitton, and F. Brooks. MACBETH: The avatar which I see before me and its move-ment toward my hand (Poster Abstract). in IEEE Virtual Reality 2007. 2007. Charlotte, NC: IEEE.

Button, B., M. Picher, and R.C. Boucher. Differential effects of cyclic and constant stress on ATP release and mucociliary transport by human airway epithelia. J Physiol. 2007. 580(Pt. 2): p. 577-92.

Cribb, J., D. Hill, R.M. Taylor II, L. Vicci, J.K. Fisher, K. Desai, M.G. Forest, and R. Superfine. Nonlinear Rheology of Entangled Lambda-DNA Solutions Via Driven Microbead Rheology. in Annual Biophysical Society Meeting. 2007. Baltimore, MD.

Cribb, J., B. David, R.M. Taylor, L. Vicci, J. Fisher, K.V. Desai, M.G. Forest, and R. Superfine. Nonlinear rheology of entangled lambda-DNA solutions via driven microbead rheology. Biophysical Journal. 2007: p. 638A-638A.

Desai, K.V., E.T. O’Brien, J. Cribb, and R. Superfine. Cellular Nonlinear creep response depends on membrane anchoring: a magnetic force study. in Biophysical Society Meeting. 2007. Baltimore, Maryland: Biophysical Journal.

Desai, K.V., E.T. O’Brien, J. Cribb, and R. Superfine. Cellular Nonlinear creep response depends on membrane anchoring: a magnetic force study. Biophysical Journal. 2007: p. 420a-420a.

Eastwood, B. and R.M. Taylor. Occlusion removal in video microscopy. Computer Analysis of Images and Patterns, Springer Berlin. 2007. 4673: p. 125�.

Evans, B.A., A.R. Shields, R.L. Carroll, S. Washburn, M.R. Falvo, and R. Superfine. Magnetically actuated nanorod arrays as biomimetic cilia. Nano Lett. 2007. 7(5): p. 1428-34.

Feng, D., D. Marshburn, D. Jen, R.J. Weinberg, R.M. Taylor, 2nd, and A. Burette. Stepping into the third dimension. J Neurosci. 2007. 27(47): p. 12757-60.

Fisher, J.K., L. Vicci, K. Bloom, E.T. O’Brien, C.W. Davis, R.M. Taylor II, and R. Superfine, Magnetic Manipulation for the Biomedical Sciences, in Handbook of Nanosciences, Engineering, and Technology, Second Edition. 2007, CRC Press LLC: Boca Raton.

Glencross, M., C. Jay, J. Feasel, L. Kohli, M.C. Whitton, and R. Hubbold. Effiective Cooperative Haptic Interaction over the Internet. in Proceedings of IEEE Virtual Reality 2007. 2007.

M. Guthold, W. Liu, E. A. Sparks, L. M. Jawerth, L. Peng, M. Falvo, R. Superfine, R. R. Hantgan, S. T. Lord (2007) “A comparison of the mechanical and structural properties of fibrin fibers with other protein fibers” Cell Biochemistry and Biophysics 49, 165-181.

Guthold, M., W. Liu, E.A. Sparks, L.M. Jawerth, L. Peng, M. Falvo, R. Superfine, R.R. Hantgan, and S.T. Lord. A comparison of the mechanical and structural properties of fibrin fibers with other protein fibers. Cell Biochem Biophys. 2007. 49(3): p. 165-81.

Hall, A.R., M.R. Falvo, R. Superfine, and S. Washburn. Electromechanical Response of Single-Walled Carbon Nanotubes to Torsional Strain in a Self-Contained Device. Nature Nanotechnology. 2007. 2: p. 413-416.

Hickey, A.J., H.M. Mansour, M.J. Telko, Z. Xu, H.D. Smyth, T. Mulder, R. McLean, J. Langridge, and D. Papadopoulos. Physical characterization of component particles included in dry powder inhalers. I. Strategy review and static characteristics. J Pharm Sci. 2007. 96(5): p. 1282-301.

Hirsh, A.J., J.R. Stonebraker, C.A. van Heusden, E.R. Lazarowski, R.C. Boucher, and M. Picher. Adenosine deaminase 1 and concentrative nucleoside transporters 2 and 3 regulate adenosine on the apical surface of human airway epithelia: implications for inflammatory lung diseases. Biochemistry. 2007. 46(36): p. 10373-83.

Jerald, J., A. Fuller, A. Lastra, M.C. Whitton, L. Kohli, and F.P. Brooks. Latency Compensaation by Horizontal Scanline Selection for Head-Mounted Displays. in Proceediings of SPIE Vol 6490 Stereoscopic Displays and Virtual Reality Systems. 2007.

Kreda, S.M., S.F. Okada, C.A. van Heusden, W. O’Neal, S. Gabriel, L. Abdullah, C.W. Davis, R.C. Boucher, and E.R. Lazarowski. Coordinated release of nucleotides and mucin from human airway epithelial Calu-3 cells. Journal of Physiology. 2007. 584(Pt 1): p. 245-59. PMC2277076

Liu, W., Bonin, K. Guthold, M. (2007) “An easy and direct method for calibrating AFM lateral force measurements” Review of Scientific Instruments 78, 063707 (7 pages)

Mitran, S. Computational model of mucociliary clearance – Relevance to therapy. Pediatric Pulmonology. 2007: p. 111-112.

Mitran, S.M. Metachronal wave formation in a model of pulmonary cilia. Comput Struct. 2007. 85(11-14): p. 763-774.

O’Brien, E.T., III, B. Wilde, S. Massenburg, K. Desai, R.M. Taylor, II, D. Marshburn, and R. Superfine. Cellular Nonlinear creep response depends on membrane anchoring: a magnetic force study. in Biophysical Society Meeting. 2007. Baltimore, Maryland: Biophysical Journal.

Peng, L., Stephens, B. J., Bonin, K., Cubicciotti, R., Guthold, M., (2007) “NanoSelection® – a Novel, Single-Cycle Method to Select Individual Aptamer Species from a Small Pool of Random Oligonucleotides” Microscopy Research and Technique 70, 372-381

Peng, L., B.J. Stephens, K. Bonin, R. Cubicciotti, and M. Guthold. A combined atomic force/fluorescence microscopy technique to select aptamers in a single cycle from a small pool of random oligonucleotides. Microsc Res Tech. 2007. 70(4): p. 372-81.

Rubinstein, M. Polymer physics of the perciliary layer. Pediatric Pulmonology. 2007: p. 112-113.

Sears, P.R., K. Thompson, M.R. Knowles, and C.W. Davis. Empirical model of ciliary dynamics for human airway epithelium. Biophysical Journal. 2007: p. 486A-486A.

Shields, A.R. Magnetically Actuated Nanorod Arrays as Biomimetic Silia. Nano Letters. 2007. 7(5): p. 1428-1434.

Spero, R.C., B. Smith, L. Vicci, J. Cribb, E.T. O’Brien, S.T. Lord, and R. Superfine. High Throughput Microbead Rheology of Fibrin Gels. in Biophysical Society Meeting. 2007. Baltimore, Maryland: Biophysical Journal.

Spero, R.C., B. Smith, L. Vicci, J. Cribb, E.T. O’Brien, S.T. Lord, and R. Superfine. High throughput microbead rheology of fibrin gels. Biophysical Journal. 2007: p. 521a-521a.

Sun, F.C., A.V. Dobrynin, D. Shirvanyants, H.I. Lee, K. Matyjaszewski, G.J. Rubinstein, M. Rubinstein, and S.S. Sheiko. Flory theorem for structurally asymmetric mixtures. Physical Review Letters. 2007. 99(13).

Tanase, M., N. Biais, and M. Sheetz. Magnetic tweezers in cell biology. Methods Cell Biol. 2007. 83: p. 473-93.

Winters, S.L., C.W. Davis, and R.C. Boucher. Mechanosensitivity of mouse tracheal ciliary beat frequency: roles for Ca2+, purinergic signaling, tonicity, and viscosity. Am J Physiol Lung Cell Mol Physiol. 2007. 292(3): p. L614-24.

Xu, K., M.G. Forest, and I. Klapper. On the correspondence between creeping flows of viscous and viscoelastic fluids. Journal of Non-Newtonian Fluid Mechanics. 2007. 145(2-3): p. 150-172.

Asokan, S., R.L. Caroll, S. Washburn, R.E. Cheney, and R. Superfine. Fluid Flow Can Steer Motile Actin Filaments in Microfluidic Channels. Biophysical Journal. 2006.

Burns, E. and F.P. Brooks Jr. Perceptual Sensitivity to Visual/Kinesthetic Discrepancy in Hand Speed, and Why We Might Care. in VRST 2006. 2006. Simassol, Cyprus.

Burns, E., S. Razzaque, A.T. Panter, M.C. Whitton, M.R. McCallus, and F.P. Brooks Jr. The Hand Is More Easily Fooled than the Eye: Users Are More Sensitive to Visual Interpenetration than to Visual-Proprioceptive Discrepancy. Journal on Presence: Teleoperators and Virtual Environments. 2006. 15(1): p. 1-15.

Burns, E., S. Razzaque, M.C. Whitton, and F.P. Brooks. MACBETH: Manadement of Avatar Conflict by Employment of a Technique Hybrid. International Journal of Virtual Reality. 2006. 6(2): p. 11-20. Burns2006

Cribb, J., D.B. Hill, J. Fisher, J. Sheehan, M. Rubinstein, M.G. Forest, and R. Superfine. Contrast and Comparison of the Microscopic and Macroscopic Rheological Properties of lambda-DNA and Human Airway Mucus. Biophysical Journal. 2006.

Fielding, J.R., D. Borland, K.H. Lee, J.P. Clarke, E. Wallen, R. Pruthi, and R.M. Taylor. Virtual pyeloscopy using volumetric depth peeling. Acad Radiol. 2006. 13(6): p. 759-63.

Fisher, J.K., J. Cribb, K.V. Desai, L. Vicci, B. Wilde, K. Keller, R.M. Taylor, J. Haase, K. Bloom, E.T. O’Brien, and R. Superfine. Thin-foil magnetic force system for high-numerical-aperture microscopy. Rev Sci Instrum. 2006. 77(2):

Fisher, J.K., L. Vicci, J. Cribb, E.T. O’Brien, R.M. Taylor, and R. Superfine. Magnetic force micromanipulation systems for the biological sciences. NANO. 2006. 1(3): p. 191-205.

Hall, A.R., L. An, J. Liu, L. Vicci, M.R. Falvo, R. Superfine, and S. Washburn. Experimental measurement of single-wall carbon nanotube torsional properties. Phys Rev Lett. 2006. 96(25): p. 256102.

Jones, M.G., M.R. Falvo, B.P. Broadwell, and S. Dotger. Self-Assembly – How Nature Builds. The Science Teacher. 2006.

Klapper, I., K. Xu, and M.G. Forest. Reciprocity Relations Between Stokes Flows of Viscous and Viscoelastic Fluids. Journal of Non-Newtonian Fluid Mechanics. 2006.

Liu, W., Jawerth, L. M., Sparks, E. A ., Falvo, M. R., Hantgan, R. R., Superfine, R., Lord, S. T., Guthold, M., (2006) “Fibrin Fibers have Extraordinary Extensibility and Elasticity” Science 313, 634

Liu, W., L.M. Jawerth, E.A. Sparks, M.R. Falvo, R.R. Hantgan, R. Superfine, S.T. Lord, and M. Guthold. Fibrin fibers have extraordinary extensibility and elasticity. Science. 2006. 313(5787): p. 634.

Martin, J., Procedural House Generation: A method for dynamically generating floor plans (Poster), in 2006 ACM Symposium on Interactive 3D Graphics and Games. 2006, ACM: Redwood City, CA.

Matsui, H., V.E. Wagner, D.B. Hill, U.E. Schwab, T.D. Rogers, B. Button, R.M. Taylor, 2nd, R. Superfine, M. Rubinstein, B.H. Iglewski, and R.C. Boucher. A physical linkage between cystic fibrosis airway surface dehydration and Pseudomonas aeruginosa biofilms. Proc Natl Acad Sci U S A. 2006. 103(48): p. 18131-6.

Muller, P., J. Cohn, D. Schmorrow, R. Stripling, K. Stanney, L. Milham, M.C. Whitton, and J. Folks. The Fidelity Matrix: Mapping System FIdelity to Training Outcome. in Proceedings of IITSEC 2007. 2006.

Peng, L., B.J. Stephens, K. Bonin, R. Cubicciotti, and M. Guthold. A Combined Atomic Force/Fluorescence Microscopy Technique to Select Aptamers in a Single Cycle from a Small Pool of Random Oligonucleotides. Microscopy Research and Technique. 2006.

Prakash, R., R. Superfine, S. Washburn, and M.R. Falvo. Functionalization of Carbon Nanotubes with Proteins and Quantum Dots in Aqueous Buffer Solutions. Applied Physics Letters. 2006. 88(063102).

Randell, S.H. and R.C. Boucher. Effective mucus clearance is essential for respiratory health. Am J Respir Cell Mol Biol. 2006. 35(1): p. 20-8.

Skinner, K., C. Dwyer, and S. Washburn. Selective functionalization of arbitrary nanowires. Nano Lett. 2006. 6(12): p. 2758-62.

Sonnenwald, D.H., M.C. Whitton, and K. Maglaughlin, Evaluation of a scientific collaboratory sytstem: Investigating a collaboratory’s potential before deployment, in Science on the Internet, A.Z.N.B. G. Olson, Editor. 2006, MIT Press: Boston.

Sul, O.J., M.R. Falvo, R.M. Taylor II, S. Washburn, and R. Superfine. Thermally Actuated Untethered Impact-Driven Locomotive Micro-Devices. Appl. Phys. Lett.. 2006. 89(20): p. 203512.

Wen, Q., C. Healey, M.C. Whitton, and R.M. Taylor II. A Comparison of User Performance in an Immersive HMD, a fish tank with Haptic Displays for Visualization of Volumetric Data. Proceedings of Applied Perception in Graphics and Visualization 2006. 2006: p. 8 pages.

Borland, D., J. Clarke, and R.M. Taylor II. Volumetric Depth Peeling for Virtual Arthroscopy. SPIE International Technical Group Newsletter. 2005. 16(2): p. 1.

Burns, E., S. Razzaque, A.T. Panter, M.C. Whitton, M.R. McCallus, and F.P. Brooks Jr. The Hand is Slower than the Eye: A quantitative exploration of visual dominance over proprioception. in Proceedings of IEEE Virtual Reality 2005. Honorable Mention in Best Paper Competition. 2005: IEEE Computer Society.

Burns, E., S. Razzaque, M.C. Whitton, M.R. McCallus, A.T. Panter, and F.P. Brooks Jr. The Hand is More Easily Fooled than the Eye: Users are more sensitive to visual interpenetration than to visual-proprioceptive discrepancy. Presence: Teleoperators and Virtual Environments. 2005.

Cribb, J., D.B. Hill, R.M. Taylor, L. Vicci, J. Fisher, K.V. Desai, B. Wilde, J. Sheehan, M.G. Forest, and R. Superfine. Measuring local microrheological properties of human mucus with magnetically driven microbeads. Biophysical Journal. 2005. 88(1): p. 505a-505a.

Fisher, J.K., J.R. Cummings, K.V. Desai, L. Vicci, B. Wilde, K. Keller, C. Weigle, G. Bishop, R.M. Taylor, C.W. Davis, R.C. Boucher, E.T. O’Brien, and R. Superfine. Three-dimensional force microscope: A nanometric optical tracking and magnetic manipulation system for the biomedical sciences. Review of Scientific Instruments. 2005. 76(5).

Hill, D.B., J. Cribb, H. Matsui, and R. Superfine. Oscillations in mucus flow. Biophysical Journal. 2005. 88(1): p. 505a-505a.

Hollins, M., F. Lorenz, A. Seeger, and R. Taylor. Factors contributing to the integration of textural qualities: evidence from virtual surfaces. Somatosens Mot Res. 2005. 22(3): p. 193-206.

Kohli, L., E. Burns, D. Miller, and H. Fuchs. Combining Passive Haptics with Redirected Walking. in the International Conference of Artificial Reality and Telexistence (ICAT) 2005. 2005. Christchurch, New Zealand.

Kohli, L. and M.C. Whitton. The Haptic Hand: Providing User Interface Feedback with the Non-Dominant Hand in Virtual Environments. in Proceedings of Graphics Interface 2005. 2005.

Marshburn, D., C. Weigle, B.G. Wilde, K. Desai, J.K. Fisher, J. Cribb, E.T. O’Brien, R. Superfine, and R.M.T. II. The Software Interface to the 3D-Force Microscope. Proceedings of IEEE Visualization. 2005: p. 455-462.

Meehan, M., S. Razzaque, B. Insko, M. Whitton, and F.P. Brooks, Jr. Review of four studies on the use of physiological reaction as a measure of presence in stressful virtual environments. Appl Psychophysiol Biofeedback. 2005. 30(3): p. 239-58.

Peng, L., R. Cubicciotti, and M. Guthold. Novel, Single-Molecule Methodology to Identify New Aptamers. Biophysical Journal. 2005. 88(1): p. 65A Part 2 Suppl S.

Stadermann, M., S.J. Papadakis, M.R. Falvo, Q. Fu, J. Liu, Y. Fridman, J.J. Borland, R. Superfine, and S. Washburn. Exponential decay of local conductance in single-wall carbon nanotubes. Phys. Rev. B.. 2005. 72(24): p. 245406.

Whitton, M.C., J. Cohn, J. Feasel, P. Zimmons, S. Razzaque, J. Poulton, B. McLeod, and F.P. Brooks Jr. Comparing VE Locomotion Interfaces. in Proceedings of IEEE Virtual Reality 2005. 2005. Bonn, Germany: IEEE Computer Society.

Whitton, M.C., J. Cohn, J. Feasel, P. Zimmons, S. Razzaque, S. Poulton, B. McLeod, and F.P. Brooks. Comparing VE Locomotion Interfaces. in Proceedings of IEEE Virtual Reality 2005. 2005.

Cohn, M.C. Whitton, W. Becker, and F.P. Brooks, Information Presentation and Control Method Impact Performance on a Complex Virtual Locomotion Task (Abstract), in Human Factors and Ergonomics Society. 2004: New Orleans, LO.

Dwyer, C., R.M. Taylor II, L. Vicci, and J. Poulton. Parallel Computer Architectures Enabled by Self-Assembly. Proceedings of the 1st Conference on the Foundations of Nanoscience. 2004. 379.

Dwyer, C., L. Vicci, J. Poulton, D. Erie, R. Superfine , S. Washburn, and R.M. Taylor II. The Design of DNA Self-Assembled Computing Circuitry. IEEE Trans. on VLSI. 2004. 12: p. 1214-20.

Dwyer, C., L. Vicci, J. Poulton, and R.M. Taylor II. DNA Self-assembled Parallel Computer Architectures. Nanotechnology. 2004. 15: p. 1688-94.

Guthold, M., Liu, W., Stephens, B. J., Lord, S. T., Hantgan, R. R., Erie, D. A., Taylor, R. M., Superfine, R. (2004) “Visualization and Mechanical Manipulations of Individual Fibrin Fibers Suggest that Fiber Cross-Section has Fractal Dimension 1.3” Biophys. J. 87, 4226-36

Guthold, M., W. Liu, B. Stephens, S.T. Lord, R.R. Hantgan, D.A. Erie, R.M. Taylor, Jr., and R. Superfine. Visualization and mechanical manipulations of individual fibrin fibers suggest that fiber cross section has fractal dimension 1.3. Biophys J. 2004. 87(6): p. 4226-36. 15465869

Hollins, M., A. Seeger, G. Pelli, and R. Taylor. Haptic perception of virtual surfaces: scaling subjective qualities and interstimulus differences. Perception. 2004. 33(8): p. 1001-19. 15521697

Hudson, T., M.C. Whitton, A. Helser, and D.H. Sonnenwald. Managing collaboration in the nanoManipulator. Presence. 2004. 13(2).

Jen, D., P. Parente, J. Robbins, C. Weigle, R.M. Taylor II, A. Burette, and R. Weinberg. ImageSurfer: A Tool for Visualizing Correlations between Two Volume Scalar Fields. in IEEE Visualization 2004 Proceedings. 2004. Austin, TX.

Jones, G., T. Tretter, A. Bokinski, and A. Negishi. Haptic technology and learning. Haptics-e. 2004.

Jones, M.G., T. Andre, D. Kubasko, A. Bokinski, T. Tretter, A. Negishi, R.M. Taylor II, and R. Superfine Hands-on Investigations with Microscopic Organisms. Science Education. 2004.

Jones, M.G., T. Andre, D. Kubasko, A. Bokinski, T. Tretter, A. Negishi, R.M. Taylor II, and R. Superfine Remote Atomic Force Microscopy of Microscopic Organisms: Technological Innovations for Hands-On Science with Middle and High School Students. Science Education. 2004. 88: p. 55-71.

Jones, M.G., J. Minogue, T. Tretter, A. Negishi, and R.M. Taylor II. Haptic augmentation of science instruction: Does touch matter? Science Education. 2004.

Jones, M.G., T. Tretter, M. Paechter, D. Kubasko, and A. Bokinski. Spectator or participant? African-American students’ writing about science. Science Education. 2004.

Labbe, J.C., E.K. McCarthy, and B. Goldstein. The forces that position a mitotic spindle asymmetrically are tethered until after the time of spindle assembly. J Cell Biol. 2004. 167(2): p. 245-56. 15492042

Lok, B., S. Naik, M.C. Whitton, and F.P. Brooks Jr. Effects of Handling Real Objects and Self-Avatar Fidelity on Cognitive Task Performance and Sense of Presence in Virtual Environments. Journal on Presence: Teleoperators and Virtual Environments. 2004. 12(6): p. 615-628.

Matthews, W.G., A. Negishi, D.M. McCarty, R.J. Samulski, R.M. Taylor II, and R. Superfine Controlled manipulation of macromolecular assemblies and microspheres over surfaces – Demonstration of rolling on the nanometer length scale. Langmuir. 2004.

Negishi, A., J. Chen, D.M. McCarty, R.J. Samulski, J. Liu, and R. Superfine. Analysis of the interaction between adeno-associated virus and heparan sulfate using atomic force microscopy. Glycobiology. 2004. 14(11): p. 969-77. 15215232

Paechter, M., M.G. Jones, T. Tretter, A. Bokinski, D. Kubasko, A. Negishi, and T. Andre. Hands-on science education: Designing instruction that is appealing to female and male students. 2004.

Painter, J., M.G. Jones, D. Kubasko, T. Tretter, A. Negishi, and T. Andre. Pulling back the curtain: Scientists in the classroom. School Science and Mathematics. 2004.

Papadakis, S.J., A.R. Hall, P.A. Williams, L. Vicci, M.R. Falvo, R. Superfine , and S. Washburn. Resonant Oscillators with Carbon-Nanotube Torsion Springs. Physical Review Letters. 2004. 93: p. 146101.

Stadermann, M., S.J. Papadakis, M.R. Falvo, J. Novak, E. Snow, Q. Fu, J. Liu, Y. Fridman, J.J. Boland, R. Superfine , and S. Washburn. Nanoscale study of conduction through carbon nanotube networks. Physical Review B. 2004. 69(20): p. 201402.

Sul, O., S.J. Papadakis, M.R. Falvo, Y. Fridman, R.M. Taylor II, R. Superfine , and S. Washburn. Bimorph actuators based on carbon nanotubes: Thermal bending of metal-nanotube cantilevers. Appl. Phys. Lett.. 2004.

Taylor II, R.M., D. Borland, F.P. Brooks Jr., M. Falvo, M. Guthold, T. Hudson, K. Jeffay, G. Jones, D. Marshburn, S.J. Papadakis, L.-C. Qin, A. Seeger, F.D. Smith, D.H. Sonnenwald, R. Superfine , S. Washburn, C. Weigle, M.C. Whitton, P. Williams, L. Vicci, and W. Robinett, Visualization and Natural Control Systems for Microscopy, in Visualization Handbook, C.J.a.C. Hansen, Editor. 2004, Harcourt Academic Press. p. 875-900.

Asokan, S.B., L.M. Jawerth, R.L. Carroll, R.E. Cheney, S. Washburn, and R. Superfine Two-Dimensional Manipulation and Orientation of Actin-Myosin Systems with Dielectrophoresis. Nano Letters. 2003. 3(4): p. 431-437.

Bokinsky, A. Data Driven Spots: A Layered Visualization Technique for the Interactive Display of Multiple 2D Scalar Variables, in Computer Science 2003, University of North Carolina: Chapel Hill

Brooks Jr., F.P., Foreword, in Level of Detail for 3D Graphics, D. Luebke, et al., Editors. 2003, Morgan Kaufmann Publishers: San Francisco, CA. p. ix.

Brooks Jr., F.P. Incorporating Dynamic Real Objects into Immersive Virtual Environments. in ACM SIGGRAPH. 2003. San Diego, CA: ACM Transactions on Graphics.

Carter, G., M.G. Jones, and M. Rua. The Effects of Partner’s Ability on the Achievement and Conceptual Organization of High Achieving Fifth Grade Students. Science Education. 2003. 87(1): p. 94-111.

Christiansen, N. and K.L. Maglaughlin. Crossing from physical workplace to virtual workspace: be aware. in International Conference on Human Computer Interaction. 2003.

Dwyer, C., R.M. Taylor II, and L. Vicci. Performance Simulation of Nanoscale Silicon Rod Field-Effect Transistor Logic. IEEE Trans. on Nanotechnology. 2003. 2(2): p. 69-74.

Hall, A., G. Matthews, R. Superfine , M. Falvo, and S. Washburn. Simple and Efficient Method for Carbon Nanotube Attachment to Scanning Probes and Other Substrates. Appl. Phys. Lett.. 2003. 82(15): p. 2506-2508.

Hudson, T., A. Helser, D.H. Sonnenwald, and M.C. Whitton. Managing Collaboration in the Distributed nanoManipulator. in IEEE Virtual Reality 2003. 2003. Los Angeles, CA: IEEE Press.

Hudson, T. Adapting Interactive Applications for Distributed Environments, in Computer Science 2003, UNC-CH: Chapel Hill

Jones, G., A. Bokinski, T. Tretter, A. Negishi, D. Kubasko, R. Superfine , and R.M. Taylor II, Atomic force microscopy with touch: Educational applications, in Science, Technology and Education of Microscopy: an Overview, A. Mendez-Vilas, Editor. 2003, Formatex: Madrid, Spain.

Jones, G., T. Andre, R. Superfine , and R.M. Taylor II. Learning at the Nanoscale: The Impact of Students’ Use of Remote Microscopy on Concepts of Viruses, Scale, and Microscopy. Journal of Research in Science Teaching. 2003. 40(3): p. 303-322.

Jones, M.G., T. Hargrove, and B. Jones. The Failed Metaphors of Teaching. The School Administrator. 2003. 60(11): p. 26-28.

Lok, B., Evaluation and Application of Algorithms for a Hybrid Environment System, in Visualization and Mechanical Manipulations of Individual Fibrin Fibers, B. Thompson, Editor. 2003, University of Rochester Press: New York. p. 149-175.

Lok, B., S. Naik, M.C. Whitton, and F.P. Brooks Jr. Effects of Handling Real Objects and Avatar Fidelity on Cognitive Task Performance in Virtual Environments. in IEEE Virtual Reality 2003. 2003. Los Angeles, CA.

Maglaughlin, K.L. An exploration of interdisciplinary academic scientific collaboration factors., in School of Information and Library Science 2003, University of North Carolina at Chapel Hill:

Meehan, M., S. Razzaque, M.C. Whitton, and F.P. Brooks Jr. Effect of Latency on Presence in Stressful Virtual Environments. in IEEE Virtual Reality 2003. 2003. Los Angeles, CA.

Papadakis, S.J., P.A. Williams, O. Sul, M.R. Falvo, R. Superfine , and S. Washburn. Mechanics of Nanotubes and Nanotube-based Devices. in International Winterschool on Electronic Properties of Novel Materials. 2003. Kirchberg, Austria.

Prakash, R., S. Washburn, R. Superfine , R.E. Cheney, and M. Falvo. Visualization of individual carbon nanotubes with fluorescence microscopy using conventional fluorophores. Appl. Phys. Lett.. 2003. 83: p. 1219-1221.

Seeger, A., C. Fretzagias, and R. Taylor, 2nd. Software acceleration techniques for the simulation of scanning electron microscope images. Scanning. 2003. 25(5): p. 264-73. 14748390

Sonnenwald, D.H. Expectations for a scientific collaboratory: A case study. in ACM GROUP 2003 Conference. 2003. NY: ACM Press.

Sonnenwald, D.H. and B. Li. Scientific collaboratories in higher education: Exploring learning style preferences and perceptions of technology. British Journal of Educational Technology. 2003. 43(3): p. 419-431.

Sonnenwald, D.H., K.L. Maglaughlin, and M.C. Whitton. Designing to support situation awareness across distances: An example from a scientific collaboratory. Information Processing & Management. 2003.

Sonnenwald, D.H., M.C. Whitton, and K.L. Maglaughlin. Evaluating a scientific collaboratory: Results of a controlled experiment. ACM Transactions on Computer Human Interaction. 2003. 10(2): p. 150-176.

Sonnenwald, D.H., M.C. Whitton, and K.L. Maglaughlin. Scientific collaboratories: Evaluating their potential. ACM Interactions. 2003. 19(4): p. 9-10.

Stadermann, M. Buckling Nanotube with Conductivity Map (Visualization Challenge). Science. 2003. 301: p. 1473.

Stadermann, M., H. Grube, J. Boland, S.J. Papadakis, M.R. Falvo, R. Superfine , and S. Washburn. Simultaneous Atomic Force Microscopy Measurement of Topography and Contact Resistance of Metal Films and Carbon Nanotubes. Review of Scientific Instruments. 2003. 74(8): p. 3653-3655.

Stilwell, J.L., D.M. McCarty, A. Negishi, R. Superfine, and R.J. Samulski. Development and characterization of novel empty adenovirus capsids and their impact on cellular gene expression. J Virol. 2003. 77(23): p. 12881-5. 14610209

Sul, O., S.J. Papadakis, M. Falvo, Y. Fridman, R.M. Taylor II, S. Washburn, and R. Superfine Bimorph actuators based on carbon nanotubes: Thermal bending of metal-nanotube cantilevers. Appl. Phys. Lett.. 2003.

Taylor II, R.M., C. Ware, and V. Interrante. Perceptually-Based Visualization Design. in Course notes for SIGGRAPH 2003 course #45, Full-day course on visualization organized by R.M. Taylor II. 2003. San Diego, CA.

Tretter, T. and G. Jones. A Sense of Scale: Studying how scale effects systems and organisms. Science Teacher. 2003. 70(1): p. 22-25.

Tretter, T. and M.G. Jones. Relationships between inquiry-based teaching and physical science standardized test scores. School Science and Mathematics. 2003. 103(7): p. 345-350.

Wang, H., Y. Yang, M.J. Schofield, C. Du, Y. Fridman, S.D. Lee, E.D. Larson, J.T. Drummond, E. Alani, P. Hsieh, and D.A. Erie. DNA bending and unbending by MutS govern mismatch recognition and specificity. Proc Natl Acad Sci U S A. 2003. 100(25): p. 14822-7. 14634210

Whitton, M.C. Making Virtual Environments Compelling. Communications of the ACM. 2003.

Williams, P., S.J. Papadakis, A. Patel, M. Falvo, S. Washburn, and R. Superfine Fabrication of Nanometer-scale Mechanical Devices Incorporating Individual Multiwalled Carbon Nanotubes as Torsional Springs. Appl. Phys. Lett.. 2003. 82: p. 805.

Zhang, J., G.L. Wang, Y.S. Shon, O. Zhou, R. Superfine , and R. Murray. Interactions of small Molecules and Au Nanoparticles with Solubilized Single-Wall Carbon Nanotubes. Journal of Physical Chemistry B. 2003. 107(16): p. 3726-3732.

Zimmons, P. The Influence of Lighting Quality on Presence and Task Performance in Virtual Environments, in Computer Science 2003, UNC-CH: Chapel Hill p.244

Brooks Jr., F.P., The History of IBM Operating System / 360, in Software Pioneers: Contributions to Software Engineering, M. Broy and E. Denert, Editors. 2002, Springer: Berlin. p. 170-178.

Dwyer, C., R. Taylor, and L. Vicci. Transport Simulation of a Nanoscale Silicon Rod Field-Effect Transistor. in IEEE 2nd Conference on Nanotechnology. 2002. Arlington, VA.

Dwyer, C., M. Guthold, M. Falvo, S. Washburn, R. Superfine, and D. Erie. DNA-functionalized single-walled carbon nanotubes. Nanotechnology. 2002. 13: p. 601-4.

Dwyer, C., R. Taylor, and L. Vicci. Mixed-Mode Simulation of Nanoscale Silicon Rod Field-Effect Transistor Logic. IEEE Trans. on Nanotechnology. 2002.

Harris, M.J., G. Coombe, T. Scheuermann, and A. Lastra. Physically-Based Visual Simulation on Graphics Hardware. in 2002 SIGGRAPH / Eurographics Workshop on Graphics Hardware. 2002. Saarbruecken, Germany.

Jones, M.G., T. Andre, D. Kubasko, A. Bokinsky, T. Tretter, A. Negishi, R. Taylor, and R. Superfine. Hands-on Investigations with Microscopic Organisms. Science Education. 2002.

Lok, B.C.L. Interacting With Dynamic Real Objects in Virtual Environments, in Computer Science 2002, University of North Carolina: Chapel Hill p.172

Maglaughlin, K.L. and D.H. Sonnenwald. User perspectives on relevance criteria: A comparison among relevant, partially relevant and not relevant judgments. Journal of the American Society of Information and Technology. 2002. 53(5): p. 327-342.

Meehan, M., B. Insko, M. Whitton, and F.P. Brooks Jr. Physiological Measures of Presence in Stressful Virtual Environments. ACM Transactions on Graphics. 2002. 21(3): p. 645-652.

Mortensen, J., V. Vinayagamoorthy, M. Slater, A. Steed, B. Lok, and M.C. Whitton. Collaboration in Tele-Immersive Environments. in Eighth Eurographics Workshop on Virtual Environments. 2002. Barcelona, Spain: ACM – The Eurographics Association.

Razzaque, S., D. Swapp, M. Slater, M.C. Whitton, and A. Steed. Redirected Walking in Place. in Eighth Eurographics Workshop on Virtual Environments. 2002. Barcelona, Spain: ACM – The Eurographics Association.

Sonnenwald, D.H., M.C. Whitton, and K.L. Maglaughlin. Scientific collaboratories. ASIS&T Bulletin. 2002. 28(6).

Superfine, R., M. Falvo, R.M. Taylor II, and S. Washburn, Nanomanipulation: Buckling, Transport and Rolling at the Nanoscale, in CRC Handbook of Nanoscience, Engineering, and Technology, S. Lyshevski, et al., Editors. 2002, CRC Press LLC: Boca Raton.

Superfine, R., G. Bishop, J. Cummings, J. Fisher, K. Keller, G. Matthews, D. Sill, R.M. Taylor II, L. Vicci, C. Weigle, G. Welch, and B. Wilde. Touching In Biological Systems: A 3D Force Microscope. in Microscopy and Microanalysis 2002. 2002. Quebec City, Canada.

Taylor II, R.M. Visualizing Multiple Fields on the Same Surface. IEEE Computer Graphics and Applications. 2002(Mar-Apr): p. 6-10.

Varadhan, G., W. Robinett, D. Erie, and R.M. Taylor II. Fast Simulation of Atomic-Force-Microscope Imaging of Atomic and Polygonal Surfaces Using Graphics Hardware. in SPIE Conference on Visualization and Data Analysis. 2002. San Jose Convention Center, San Jose, CA.

Washburn, S. and S.J. Papadakis. Transport across atomically aligned interfaces: Fingertip manipulation and electrical probing of nanotubes. in International Workshop on Electron Interference and Decoherence in Nanostructures. 2002. Max Planck Institute for Physics of Complex Systems.

Williams, P.A., S.J. Papadakis, M.R. Falvo, A.M. Patel, M. Sinclair, A. Seeger, A. Helser, R.M. Taylor II, S. Washburn, and R. Superfine. Controlled placement of an individual carbon nanotube onto a microelectromechanical structure. Applied Physics Letters. 2002. 80(14): p. 2574-2576.

Williams, P.A., S.J. Papadakis, A.M. Patel, M.R. Falvo, S. Washburn, and R. Superfine. Torsional response and stiffening of individual multiwalled carbon nanotubes. Phys Rev Lett. 2002. 89(25): p. 255502. 12484895

Brooks Jr., F.P. The History of IBM Operating System/360. in SD&M Software Pioneers Conference. 2001. Bonn, Germany.

Guthold, M. and D.A. Erie. Single-molecule study reveals a complex E. coli RNA polymerase. Chembiochem. 2001. 2(3): p. 167-70. 11828441

Guthold, M., R. Superfine, and R.M. Taylor II. The rules are changing: Force measurements on single molecules and how they relate to bulk reaction kinetics and energies. Biomedical Microdevices. 2001. 3(1): p. 9-18.

Harris, M. and A. Lastra. Real-Time Cloud Rendering. Computer Graphics Forum. 2001. 20(3): p. 76-84.

Hudson, T.C., M.C. Weigle, K. Jeffay, and R.M. Taylor II. Experiments in Best-Effort Multimedia Networking for a Distributed Virtual Environment. Proceedings of Multimedia Computing and Networking. 2001(January): p. 88-98.

Insko, B. Passive Haptics Significantly Enhances Virtual Environments, in Computer Science 2001, University of North Carolina: Chapel Hill

Jeffay, K., T. Hudson, and M. Parris. Beyond Audio and Video: Multimedia Networking Support for Distributed, Immersive Virtual Environment. in 27th EUROMICRO Conference. 2001. Warsaw, Poland.

Lindholm, E., M.J. Kligard, and H. Moreton. A user-programmable vertex engine. in International Conference on Computer Graphics and Interactive Techniques. 2001: ACM Press.

Lok, B. Online Model Reconstruction for Interactive Virtual Environments. in ACM Symposium on Interactive 3D Graphics. 2001.

Meehan, M., B. Insko, M.C. Whitton, and F.P. Brooks. Physiological Measures of Presence in Virtual Environments. in 4th International Workshop on Presence. 2001. Philadelphia.

Meehan, M. Physiological Reaction as an Objective Measure of Presence in Virtual Environments, in Computer Science 2001, University of North Carolina: Chapel Hill p.142

Razzaque, S., Z. Kohn, and M.C. Whitton. Redirected Walking. in Eurographics 2001. 2001.

Seeger, A., S. Paulson, M. Falvo, A. Helser, R.M. Taylor, R. Superfine, and S. Washburn. How does it feel to roll a molecule? in 45th International Conference on Electron, Ion and Photon Beam Technology and Nanofabrication. 2001.

Seeger, A., S. Paulson, M. Falvo, A. Helser, R.M. Taylor II, R. Superfine, and S. Washburn. Hands-on tools for nanotechnology. Journal of Vacuum Science & Technology. 2001. B 19: p. 2717-2722.

Sonnenwald, D.H., R. E. Bergquist, K. L. Maglaughlin, E. Kupstas-Soo, and M.C. Whitton, Designing to support colaborative scientific research across distances: The nanoManipulator environment, in Collaborative Virtual Environments, E. Churchill, D. Snowdon, and A. Munro, Editors. 2001, Springer Verlag: London. p. 202-224.

Sonnenwald, D.H., K.L. Maglaughlin, and M.C. Whitton. Using Innovation Diffusion Theory to Guide Collaboration Technology Evaluation: Work in Progress. in IEEE 10th International Workshop on Enabling Technologies for Collaborative Enterprises (WETICE). 2001. NY: IEEE Press.

Taylor II, R.M., T.C. Hudson, A. Seeger, H. Weber, J. Juliano, and A.T. Helser. VRPN: A Device-Independent, Network-Transparent VR Peripheral System. in ACM Symposium on Virtual Reality Software & Technology 2001. 2001. Banff Centre, Canada.

Arthur, K. Effects of Field of View on Performance with Head-Mounted Displays, in Computer Science 2000, University of North Carolina: Chapel Hill

Brooks Jr., F.P. The Design of Design. in Turing Award address at SIGGRAPH 󈧄. 2000: Communications of the ACM.

Christiansen, M., K. Jeffay, D. Ott, and F.D. Smith. Tuning RED for Web Traffic. in ACM SIGCOMM. 2000. Stockholm, Sweden.

Falvo, M.R., J. Steele, R.M.T. II, and R. Superfine. Gearlike rolling motion mediated by commensurate contact: Carbon nanotubes on HOPG. Phys. Rev. B. 2000. 62(October 15): p. 10665-10667.

Falvo, M.R., J. Steele, R.M.T. II, and R. Superfine. Evidence of commensurate contact and rolling motion: AFM manipulation studies of carbon nanotubes on HOPG. Tribology Letters. 2000. 9: p. 73-76.

Falvo, M.R. and R. Superfine. Mechanics and friction at the nanometer scale. Journal of Nanoparticle Research. 2000. 2: p. 237-248.

Gregory, A., M.C. Lin, S. Gottschalk, and R.M.T. II. Real-Time Collision Detection for Haptic Interaction Using a 3-DoF Force Feedback Device. Computational Geometry: Theory and Applications (Special Issue on Virtual Environments). 2000. 15(1-3): p. 69-89.

Guthold, M., M.R. Falvo, W.G. Matthews, S. Paulson, S. Washburn, D. Erie, R. Superfine, F.P. Brooks, and R.M. Taylor. Controlled Manipulation of Molecular Samples with the nanoManipulator. IEEE/ASME Transactions on Mechatronics. 2000. 5(2): p. 189-198.

Guthold, M., J. Mullin, S. Lord, D. Erie, R. Superfine, and R. Taylor. Controlled Manipulation of Individual Fibrin Molecules. Biophys. J.. 2000. 78: p. A53.

Paulson, S., A. Helser, M.B. Nardelli, R.M.T. II, M. Falvo, R. Superfine, and S. Washburn. Tunable resistance of a carbon nanotube-graphite interface. Science. 2000. 290(December): p. 1742-1744.

Rivetti, C., M. Guthold, and C. Bustamante, DNA wrapping in E. coli RNA polymerase open promoter complexes revealed by scanning force microscopy, in Protein-DNA interactions: A Practical Approach, A. Travers and M. Buckle, Editors. 2000, Oxford University Press: Oxford.

Seeger, A., A. Henderson, G.L. Pelli, M. Hollins, and R.M.T. II. Haptic Display of Multiple Scalar Fields on a Surface. in Workshop on New Paradigms in Information Visualization and Manipulation. 2000. Washington, D.C.: ACM Press.

Sincell, M. NanoManipulator Lets Chemists Go Mano a Mano with Molecules. Science. 2000. 290(November 24): p. 1530.

Superfine , R., G. Jones, and R.M. Taylor II. Touching Viruses in a Networked Microscopy Outreach Project. in Conference on K-12 Outreach From University Science Departments. 2000. North Carolina State University: Science House.

Taylor II, R.M. Practical Scientific Visualization Examples. Computer Graphics. 2000. 34(1): p. 74-79 and cover.

Weigle, C., W.G. Emigh, G. Liu, R.M. Taylor, J.T. Enns, and C.G. Healey. Oriented texture slivers: A technique for local value estimation of multiple scalar fields. in Graphics Interface. 2000. Montreal, Canada.

Bastos, R., K. Hoff, W. Wynn, and A. Lastra. Increased Photorealism for Interactive Architectural Walkthroughs. in Proceedings of the 1999 Symposium on Interactive 3D Graphics. 1999.

Brooks Jr., F.P. What’s Real About Virtual Reality? IEEE Computer Graphics and Applications. 1999. 19 (6)(Nov/Dec): p. 16-27.

Bustamante, C., M. Guthold, X. Zhu, and G. Yang. Facilitated target location on DNA by individual Escherichia coli RNA polymerase molecules observed with the scanning force microscope operating in liquid. J Biol Chem. 1999. 274(24): p. 16665-8. 10358002

Clark, M. and K. Jeffay. Application-Level Measurements of Performance on the vBNS. in IEEE International Conference on Multimedia Computing and Systems. 1999. Florence, Italy.

Falvo, M.R., G. Clary, A. Helser, S. Paulson, R.M. Taylor II, V. Chi, F.P. Brooks Jr., S. Washburn, and R. Superfine. Nanomanipulation experiments exploring frictional and mechanical properties of carbon nanotubes. Microscopy and Microanalysis. 1999. 4: p. 504-512.

Falvo, M.R., R.M. Taylor, 2nd, A. Helser, V. Chi, F.P. Brooks, Jr., S. Washburn, and R. Superfine. Nanometre-scale rolling and sliding of carbon nanotubes. Nature. 1999. 397(6716): p. 236-8. 9930698

Gregory, A., M.C. Lin, S. Gottschalk, and R. Taylor. H-COLLIDE: A Framework for Fast and Accurate Collision Detection for Haptic Interaction. in Proceedings of VR 󈨧. 1999. Houston, Texas.

Guthold, M., M. Falvo, W.G. Matthews, S. Paulson, J. Mullin, S. Lord, D. Erie, S. Washburn, R. Superfine, F.P. Brooks, Jr., and R.M. Taylor, 2nd. Investigation and modification of molecular structures with the nanoManipulator. J Mol Graph Model. 1999. 17(3-4): p. 187-97. 10736776

Guthold, M., M.R. Falvo, W.G. Matthews, S. Paulson, S. Washburn, D. Erie, R. Superfine, J. F. P. Brooks, and R.M.T. II. Controlled Manipulation of Molecular Samples with the nanoManipulator. 1999.

Guthold, M., G. Matthews, A. Negishi, R.M. Taylor II, D. Erie, F.P. Brooks Jr., and R. Superfine. Quantitative Manipulation of DNA and Viruses with the nanoManipulator Scanning Force Microscope. Surf. Interf. Analysis. 1999. 27: p. 437-443.

Guthold, M., X. Zhu, C. Rivetti, G. Yang, N.H. Thomson, S. Kasas, H.G. Hansma, B. Smith, P.K. Hansma, and C. Bustamante. Direct observation of one-dimensional diffusion and transcription by Escherichia coli RNA polymerase. Biophys J. 1999. 77(4): p. 2284-94. 10512846

Jeffay, K. Towards a Better-Than-Best-Effort Forwarding Service for Multimedia Flows. IEEE Multimedia. 1999. 6(4 (October-December)): p. 84-88.

Jones, G.M., R. Superfine, and R.M.T. II. Virtual Viruses. Science Teacher. 1999. 66(7): p. 48-50.

Matthews, W.G., A. Negishi, A. Seeger, R. Taylor, D.M. McCarty, R.J. Samulski, and R. Superfine. Elasticity and binding of adenovirus in air and in liquid. Biophysical Society 43rd annual meeting, Feb. 13-17, 1999, Baltimore, MD Biophys. J.. 1999. A27.

Negishi, A., W.G. Matthews, D.M. McCarty, R.J. Samulski, D. Rohrer, A. Henderson, R. Taylor, and R. Superfine. Probing the structural properties of adenovirus using the atomic force microscope. Biophysical Society 43rd annual meeting, Feb. 13-17, 1999, Baltimore, MD Biophys. J.. 1999. 76: p. A27.

Paulson, S., M.R. Falvo, N. Snider, A. Helser, T. Hudson, A. Seeger, R.M. Taylor, R. Superfine, and S. Washburn. In Situ Resistance Measurements of Strained Carbon Nanotubes. Applied Physics Letters. 1999. 75(19): p. 2936-2938.

Rivetti, C., M. Guthold, and C. Bustamante. Wrapping of DNA around the E.coli RNA polymerase open promoter complex. Embo J. 1999. 18(16): p. 4464-75. 10449412

Sonnenwald, D.H., E. Kupstas Soo, and R. Superfine A Multi-Dimensional Evaluation of the nanoManipulator, a Scientific Collaboration System. ACM SIGGROUP Bulletin. 1999. 20(2): p. 46-50.

Taylor II, R.M. and R. Superfine, Advanced Interfaces to Scanned-Probe Microscopes, in Handbook of Nanostructured Materials and Nanotechnology, H.S. Nalwa, Editor. 1999, Academic Press: New York. p. 271-308.

Taylor II, R.M. Scientific Applications of Force Feedback: Molecular Simulation and Microscope Control. in SIGGRAPH 󈨧. 1999. Los Angeles, CA.

Usoh, M., K. Arthur, M.C. Whitton, R. Bastos, A. Steed, M. Slater, and F.P. Brooks. Walking > walking-in-place > flying in virtual environments. in Proc. of SIGGRAPH 󈨧, Computer Graphics Proceedings, Annual Conference Series. 1999.

Arthur, K., T. Preston, R. Taylor, F.P.B. Jr., M.C. Whitton, and W.V. Wright. The PIT: Design, Implementation, and Next Steps. in 2nd International Immersive Projection Technology Workshop. 1998. Ames, Iowa.

Grant, B., A. Helser, and R.M. Taylor II. Adding Force Display to a Stereoscopic Head-Tracked Projection Display. in VRAIS 󈨦. 1998. Atlanta, GA.

Ratcliff, G.C., D.A. Erie, and R. Superfine. Photothermal oscillation for oscillating mode atomic force microscopy in solution. Appl. Phys. Lett.. 1998. 72(15): p. 1911-1913.

Robinett, W. Switching Among the Four Modes of a Teleoperator System: Teleoperation, Simulation, Replay and Robot. in International Conference on Artificial Reality and Tele-existence. 1998. Tokyo, Japan.


Materials and methods

Mutant alleles

Histochemical detection of β-galactosidase activity and antibody staining

The histochemical staining was performed on hand-dissected guts according to Murakami et al. (1994). Antibody staining of embryos was done by standard methods with anti-Ultrabithorax and anti-Labial antibodies (Panganiban et al. 1990), or the anti-myc tag monoclonal 9E10 (Oncogene Research Products) at 1:500, followed by enhancement with the Vectastain Elite ABC kit. Stained embryos and dissected guts were photographed with either a Zeiss Axiophot microscope and the images scanned with a Nikon Coolscan, or were photographed with a Spot digital camera on a Leica DMR microscope. The digital images were assembled with Adobe Photoshop 4.0, and labeled with FreeHand 8.0 on a Power Macintosh.

Construction of genes encoding Torso/βcytfusion proteins

The UAS–torso WT /βcytgene was constructed by combining, in a series of steps, the following five DNA fragments: (1) a KpnI–CelII (filled in) fragment from pUAST (Brand and Perrimon 1993) containing the UAS promoter and 36 nucleotides of HSP70 5′ untranslated sequence (2) an XhoI (filled in) to SspBI fragment from pBD490 (B. Dickson and E. Hafen, pers. comm.) containing a signal sequence followed by a myc tag and the amino terminus of the Torso extracellular domain (3) an SspBI–EcoRI (filled in) fragment fromtorsoWT–sev (Dickson et al. 1992) containing the rest of the Torso extracellular domain and the transmembrane domain (4) aBamHI (trimmed with mung bean nuclease) to SpeI fragment from pβcyt (see below) containing the cytoplasmic domain of the integrin βPS subunit (5) aSpeI–RsrII fragment containing the polyadenylation site of the rosy gene (Martin-Bermudo et al. 1997). The gene was cloned between KpnI and RsrII sites in a P-element vector containing the white gene as a selectable marker (pWhiteRabbit, N.H. Brown unpubl.). The plasmid pβcyt, which contains a BamHI site at the junction between the transmembrane and cytoplasmic domains of the βPS subunit, was generated by PCR, with the primer GGAGGATCCTCACTACGATCCAC and a primer in the vector, cloned as a BamHI–NotI fragment and checked by sequencing (the SpeI site used for fragment 4 is within the 3′ untranslated region of theβPS gene). The amino acid sequences at the junctions between transmembrane and cytoplasmic domains are -LLLWKLLTTIHDRR- in the βPS subunit and -LTFC RILTTIHDRR- in the Torso WT /βcyt fusion (the Torso sequence is underlined and the junction amino acids RI come from the synthetic EcoRI site). To generate theUAS–torso D /βcytgene, a NgoMI–EcoRI fragment fromUAS–torso WT /βcytwas replaced with the corresponding fragment fromtorso4021–sev (Dickson et al. 1992). P-element transformants were obtained by standard methods, and several lines were obtained for each construct. Independent lines of the constructs were used lines B, E2 and D1 for the UAS–torso WT /βcytgene and lines B and C for theUAS–torso D /βcytgene. They were expressed in the midgut by the GAL4 line 48Y, which is expressed in the midgut from stage 12 onwards (Martin-Bermudo et al. 1997). To unambiguously distinguish the mew mutant embryos, we used a balancer chromosome marked with yellow + (Martin-Bermudo et al. 1997), for example, virgin females y mew M6 /FM6, y + UAS–torso D /βcyt were crossed toy + /Y 24B 258 males. In the offspring, all will express UAS–torso D /βcytunder the control of 48Y and contain the 258 enhancer trap, and the 1/4 that are mutant for mew can be distinguished by theiry mouth hooks.

To assess the role of the α subunits, we used the following UAS constructs: UAS–PS1 2.1, UAS–PS1/2cyt 2.1, UAS–PS2/1cyt 2.A, UAS–PS2 2A (Martin-Bermudo et al. 1997).


Tumor Biology (10/13)

-Protect the open ends of chromosomes from recombination, end-to-end fusion, and recognition as damaged DNA
-Enables complete DNA replication
-Associate with each other to regulate transcription, facilitate sister chromosome pairing at mitosis, and anchor chromosomes to nuclear membranes

Self-renewal (can form two daughter cells with one or both retaining the same biologic properties as the parent cell)

Long term maintenance of the tumor

This leads to increase glucose uptake (because it is less efficient) due to shift in isozymes

Early tumor expands --> outgrows diffusion limits of local blood supply --> hypoxia --> stabilization of HIF

Adipocytes - increased tumor cell migration, invasion by regulating expression and activation of MMPs, pro-inflammatory adipokines

ECs - leukocyte recruitment and tumor cell behavior and metastasis, form angiogenic vessels, MMP and TIMP expression to influence tumor progression

Pericytes - stabilize blood vessels, inhibit EC proliferation, maintain capillary diameter, regulate blood flow, provide EC survival signals via heterotypic contacts and soluble factors

DCs - induce vascularity, tumor immune-pathogenesis, pro and anti-tumor functions

Macrophages - immune regulation, cell growth and tumor development

Immune cells - growth and progression via TAMs and myeloid derived suppressive cells and their cytokines (IL-23, IL-6, IL-1B and TNF-a)


Integrin activation and structural rearrangement

Authors' addresses Junichi Takagi, Timothy A. Springer,The Center for Blood Research, Departments of Pathology and Pediatrics, Harvard Medical School, Boston, Massachusetts, USA.

Authors' addresses Junichi Takagi, Timothy A. Springer,The Center for Blood Research, Departments of Pathology and Pediatrics, Harvard Medical School, Boston, Massachusetts, USA.

Authors' addresses Junichi Takagi, Timothy A. Springer,The Center for Blood Research, Departments of Pathology and Pediatrics, Harvard Medical School, Boston, Massachusetts, USA.

Authors' addresses Junichi Takagi, Timothy A. Springer,The Center for Blood Research, Departments of Pathology and Pediatrics, Harvard Medical School, Boston, Massachusetts, USA.

Junichi TakagiTimothy A. Springer

Abstract

Summary: Among adhesion receptor families, integrins are particularly important in biological processes that require rapid modulation of adhesion and de-adhesion. Activation on a timescale of < 1 s of β2 integrins on leukocytes and β3 integrins on platelets enables deposition of these cells at sites of inflammation or vessel wall injury. Recent crystal, nuclear magnetic resonance (NMR), and electron microscope (EM) structures of integrins and their domains lead to a unifying mechanism of activation for both integrins that contain and those that lack an inserted (I) domain. The I domain adopts two alternative conformations, termed open and closed. In striking similarity to signaling G-proteins, rearrangement of a Mg 2+ -binding site is linked to large conformational movements in distant backbone regions. Mutations that stabilize a particular conformation show that the open conformation has high affinity for ligand, whereas the closed conformation has low affinity. Movement of the C-terminal α-helix 10 Å down the side of the domain in the open conformation is sufficient to increase affinity at the distal ligand-binding site 9000-fold. This C-terminal “bell-rope” provides a mechanism for linkage to conformational movements in other domains. Recent structures and functional studies reveal interactions between β-propeller, I, and I-like domains in the integrin headpiece, and a critical role for integrin epidermal growth factor (EGF) domains in the stalk region. The headpiece of the integrin faces down towards the membrane in the inactive conformation, and extends upward in a “switchblade”-like opening upon activation. These long-range structural rearrangements of the entire integrin molecule involving interdomain contacts appear closely linked to conformational changes within the I and I-like domains, which result in increased affinity and competence for ligand binding.


Results

MTT assay

EGF concentrations and treatment times were based on previous studies with colon cancer cell lines. Specifically, HCT116 cells were treated with 1, 10, or 100 ng/mL EGF for 5, 30 min, 1, 12, 24, or 48 h, and proliferation was assessed by the MTT assay. These analyses revealed that HCT116 cell proliferation gradually increased in a concentration- and time-dependent manner (Fig. 1).

Changes of EGF-treated HCT116 cells. The optimal EGF concentration for future experiments was set at 100 ng/mL, and the optimal EGF exposure time was set at 24 and 48 h mainly (CTL control)

Alterations in integrin β1 and Rab25 expression following EGF exposure

HCT116 cells were exposed to 100 ng/mL EGF for 24 h, and integrin β1 and Rab25 expression was monitored by western blotting (Fig. 2). Notably, integrin β1 expression increased over time in response to EGF stimulation, peaking at 16 h and decreasing thereafter relative to the β-actin control (p < 0.05 Fig. 2a, b). A similar result was found for Rab25 expression, which also increased in response to EGF treatment (p < 0.05 Fig. 2a, c). Interestingly, prolonged exposure to EGF for 48 h resulted in a significant decrease in integrin β1 expression when compared to basal levels (p = 0.026 Fig. 3).

Integrin β1 and Rab25 expression in EGF-treated cells. a Integrin β1 and Rab25 expression was examined in HCT116 cells stimulated with 100 ng/mL EGF by western blotting. b, c Densitometric quantification of the data shown in a for b integrin β1 and c Rab25 (CTL control)

Integrin β1 expression following EGF stimulation for 48 h. a Integrin β1 expression following stimulation with 100 ng/mL EGF was monitored by western blotting. b Densitometric quantification of the data shown in a (p = 0.026)

Effects of EGF treatment on integrin β1 trafficking and secretion

To determine whether EGF stimulation altered the localization of integrin β1, HCT116 cells were treated with 100 ng/mL EGF and then subjected to subcellular fractionation and western blot analysis. These results demonstrated that integrin β1 was almost exclusively localized to the membrane fraction, and its expression progressively decreased in response to EGF treatment at 24 and 48 h (p = 0.026 Fig. 4a). Because integrin β1 was not detected in the cytosolic fraction, we performed ELISA analyses with culture media collected after 48 h of exposure to 100 ng/mL EGF. As a result, we found an increase in integrin β1 levels from 0.451 ng/mL in untreated cultures to 0.616 ng/mL after 48 h of EGF treatment (Fig. 4b). Relative changes in integrin β1 localization in the cytosol, membrane, and culture supernatants are shown in Fig. 4c.

Analysis of integrin β1 localization and shedding. a Integrin β1 localization in the membrane and cytosol was examined by subcellular fractionation and western blotting. b Integrin β1 shedding was monitored by ELISA after stimulation with EGF for 48 h. c EGF-dependent changes in integrin β1 subcellular localization were examined by densitometric quantification of data shown in a

Respective effects of Rab25 expression and EGF stimulation on integrin β1 expression and trafficking

We next sought to determine whether integrin β1 expression was regulated by Rab25. For this, we transfected HCT116 colon cancer cells with Rab25-specific siRNA and confirmed sufficient knockdown by western blotting (Fig. 5a). Subsequent analysis of integrin β1 levels revealed a significant decrease following Rab25 knockdown (p = 0.003 Fig. 5b). Moreover, membrane/cytosolic fractionation demonstrated that although integrin β1 was still undetectable in the cytoplasm, a marked increase occurred in the membrane fraction after 24 h of EGF treatment (p = 0.001) (Fig. 5c).

Alterations in integrin β1 localization after Rab25 knockdown. a Integrin β1 and Rab25 expression was monitored by western blotting after fractionation. b Densitometric quantification of integrin β1 expression in mock and Rab25-knockdown cells. c Densitometric quantification of data shown in a (CTL control)

Further densitometric analysis was performed to determine the effects of EGF stimulation and Rab25 expression on integrin β1 localization. Notably, the low levels of integrin β1 in the cytosol were further reduced in response to EGF exposure (p = 0.045), whereas an opposite effect was observed in EGF-treated Rab25 knockdown cells (p = 0.011 Fig. 6a). Additionally, EGF stimulation decreased membrane integrin β1 levels in control cells (p < 0.001) however, this was reversed in Rab25 knockdown cells, where integrin β1 levels in the membrane increased following EGF treatment (p = 0.001) (Fig. 6b).

Changes of integrin β1 expression in response to EGF stimulation and Rab25-knockdown. a, b Relative distribution of integrin β1 in a cytosol and b membrane following EGF stimulation in control (CTL control, solid line) and Rab25-knockdown (siRab25, dotted line) cells


Conclusion

This review explored the opposing nature of β2 integrin pro- and anti-inflammatory functions in three main immune functions, making them prime candidates to be both important mediators and regulators of the immune system. The first is migration, which allows for targeted immune cell recruitment to sites of infection and tissue damage. The second is adhesion, not only preceding immune cell extravasation at sites of inflammation, but also an important factor in initiating the adaptive immune response by facilitating cellular interactions. Finally, immune cell signaling, which allows for fine-tuned cooperation between a wide variety of immune cells. Considering the fact that β2 integrins play a complex role in three important areas of the immune system and their differential expression on monocytes, macrophages and DCs, it becomes clear that the variety of studies presented in this review is by no means exhaustive. The common message is evident: β2 integrins are involved in complex immunoregulatory signaling pathways. However, in addition to their well-established pro-inflammatory roles in recruitment and activation, β2 integrins also have essential immunoregulatory functions. Dysregulated integrin signaling, expression and surface activation is therefore likely to contribute to a variety of inflammatory and autoimmune conditions. Elucidating the function of β2 integrins further therefore promises to provide novel therapeutic targets for various disorders, RA being just one example.


4 CONCLUSIONS AND PERSPECTIVES

Overall, GPCRs participate in every aspect of epidermal stem cell biology, maintaining the identity of adult epithelial stem cells, coordinating interactions of stem cells with their niche and integrating extrinsic signals to help stem cells adapt to environmental changes. While we made an effort to link effects of GPCRs and ligands into the regulation of stem cells, it is evident more specific models in which GPCRs are knockout or overexpressed in particular stem cell compartments are needed to dissect the contribution of receptors to stem cell fate. More sensitive single cell analysis that detects low-expressed genes would greatly improve our understanding of the pool of GPCRs expressed in each epidermal stem cell compartment. Further advances are also needed in the validation of mouse models on human skin biology due to the differences in skin structure, immune modulators and GPCR genes specific to each species.

Although in this review we focused on the roles of nonsensory GPCRs, keratinocytes have been shown to express sensory receptors like light-activated opsins. 112 Furthermore, numerous nutrients and microbial metabolites activate GPCRs, 113 indicating that this receptor family may function as a link between diet, microbiome and somatic stem cells. The precise role of GPCRs in transducing light, dietary and microbiome clues to coordinate epithelial stem cell fate is an exciting and underexplored area. Another fascinating aspect of GPCR signaling is its role regulating tumor suppression and promotion. Numerous GPCRs and heterotrimeric G proteins are mutated in cancer and cAMP has a prominent role in modulating pathways that intersect with tumor progression, including prostaglandins, Hedgehog and Hippo signaling. More research into the specific GPCRs, signaling partners and cells involved will help design therapeutic strategies targeting intrinsic stemness pathways associated with malignant transformation and tumor growth.

Finally, though GPCR signals are transient and numerous pathways are concomitantly activated to desensitize receptors and terminate intracellular cascades, these transient signals have long lasting effects in epithelial stem cell fate. A better understanding of how GPCR signaling interplays with transcriptional and epigenetic regulation will provide important insights into mechanisms involved in the maintenance of stem cell identity and the approaches stem cells utilize to respond and adapt to microenvironmental changes.


Watch the video: Fibronectin (September 2022).


Comments:

  1. Seager

    It is remarkable, it is a valuable phrase

  2. Tlexictli

    I think they will help you find the right solution. Don't be upset.

  3. Akia

    Yes indeed. All of the above is true. We can communicate on this theme. Here or at PM.

  4. Kay

    It is interesting. Where can I find out more about this?

  5. Kade

    What great interlocutors :)

  6. Drygedene

    You are not right. I am assured. Write to me in PM, we will talk.



Write a message