Information

Concentration of DNA by isopropanol

Concentration of DNA by isopropanol


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

I have read that DNA can be concentrated by addition of isopropanol.

What does "concentrated" mean? What does isopropanol do on a molecular level to concentrate DNA?


What you are asking about is the precipitation of DNA (or any other nucleic acid) by isopropanol (or ethanol, which is more common). To do so, you add salt (usually slightly acidic sodium acetate) which makes sure that the phosphate backbone of the DNA is saturated with sodium ions to make it less soluble. Then you add the organic solvent, which precipitates the DNA from the solution by changing the polarity of the solution. This makes the ions form salts and the DNA precipites. The principle is explained in the Wikipedia article on ethanol precipitation. Finally the solution is centrifuged to collect the DNA at the bottom of your reaction tube and to be able to take off the supernatant.


Concentration of DNA by isopropanol - Biology

This procedure is used to extract plasmid DNA from bacterial cell suspensions and is based on the alkaline lysis procedure developed by Birnboim and Doly (Nucleic Acids Research 7:1513, 1979). The procedure takes advantage of the fact that plasmids are relatively small supercoiled DNA molecules and bacterial chromosomal DNA is much larger and less supercoiled. This difference in topology allows for selective precipitation of the chromosomal DNA and cellular proteins from plasmids and RNA molecules. The cells are lysed under alkaline conditions, which denatures both nucleic acids and proteins, and when the solution is neutralized by the addition of Potassium Acetate, chromosomal DNA and proteins precipitate because it is impossible for them to renature correctly (they are so large). Plasmids renature correctly and stay in solution, effectively separating them from chromosomal DNA and proteins. Cool, no?

Note: The procedure below is used to make duplicate minipreps. This provides balanced tubes for the centrifuge as well as twice as much product when you are finished.

1. Gently swirl the contents of the culture tube to resuspend the cells.

2. Label two 1.5 mL tubes and pipet 1000 uL of the cell suspension into each tube.

    This part of the procedure collects the bacterial cells which are suspended in the liquid medium into a cell pellet at the bottom of the tube.
    The cells are now resuspended in a buffered solution with RNase. When the cells are lysed in the next step, the RNase will catalyze hydrolysis of all RNA molecules into nucleotides, but the DNA will not be affected.
    SDS is an acronym for Sodium Dodecyl Sulfate. It is an ionic detergent which disrupts cell membranes and destabilizes all hydrophobic interactions holding various macromolecules in their native conformation. The high pH of the 0.2 M NaOH also denatures macromolecules by changing the condition of ionizable groups (ionizing certain groups and deionizing others). The clearing you see is because the cells are lysing. The viscosity of the solution is increased by the increase in concentration of macromolecules in solution (a result of the cell lysis).
    This is really the key step in the alkaline lysis procedure. The low pH of the Potassium acetate solution neutralizes the NaOH and when the pH returns to near-neutrality then the macromolules renature. The proteins and large DNA molecules do not renature correctly however. They form hydrophobic, ionic and hydrogen bonds with each other nonspecifically because the correct conformation of the molecule was not maintained during denaturation. The plasmid DNA molecules, however, never really fully denatured because they are small circular molecules which are supercoiled. Even though the hydrogen bonds between base pairs were broken by the high pH, they reform correctly when the pH is lowered. The large DNA molecules (chromosomal DNA) and proteins form precipitates because they bind to each other in a large aggregate but the plasmids don't precipitate because they renature correctly and don't become part of the large multi-molecule aggregates. Thus plasmid DNA remains in solution while proteins and other DNA molecules precipitate.

10. Place the tubes in a centrifuge (balanced) and spin at maximum speed for 5 minutes. Team up with some other folks on this spin. The precipitate will pellet along the side of the tube.

11. Transfer the supernatants into clean 1.5 mL tubes, being careful not to pick up any of the precipitate. Discard the tubes with the precipitate and KEEP the tubes with the supernatant.

    This concentration of isopropanol will cause the DNA to become insoluble. Since DNA molecules are ionic (uniform negative charge due to the phosphates) they are highly soluble in water but not soluble in organic solvents. Isopropanol and ethanol are commonly used to precipitate DNA from aqueous solution.

14. Add 200 uL of absolute ethanol to each tube and mix by inversion several times.

    This "ethanol wash" will speed up the process because the next step is to evaporate the alcohol used in the precipitation step. Absolute Ethanol evaporates much faster than a solution of 50% isopropanol.

17. Place the tubes in the fume hood with the caps open for 15-20 minutes to dry off the last traces of ethanol.


Genomic DNA Isolation

Yield, purity and integrity are essential to performance in downstream applications such as PCR and sequencing. Optimization of extraction methodologies is key for success with challenging sample types and demanding downstream applications. The purified target DNA should be free of contaminants, including proteins, other cellular components and undesired nucleic acids.

Specialized, sample-type specific purification kits may be needed for more complex and challenging samples that contain degraded DNA or a have low concentrations of DNA. Challenging sample types include FFPE tissue, plasma or serum containing cell-free DNA, forensic samples or any source where the sample quantity is limiting.

Promega was one of the first companies to provide kits for the purification of DNA, as well as plasmids, with over 30 years of experience in nucleic acid extraction. We offer a wide range of genomic DNA extraction kits suitable for a variety of sample types and throughput needs, producing high yields and high-quality DNA for use in your downstream applications. Our products cover a variety of throughput options and processing methods suitable to your specific needs&mdashfrom manual single-preps to small benchtop or large-scale automated systems.

Utilizing spin, vacuum or magnetic-based methods, our manual single-prep solutions are best for processing less than 24 samples at a time. If you are looking for an automated solution, our cartridge-based kits for use with Maxwell® Instruments can process up to 48 samples in the same run. We also offer fully automated high-throughput extraction options utilizing plate-based processing methods, fully compatible with liquid handling platforms.

Although techniques like Southern blotting, which require microgram amounts of DNA, are still performed in molecular biology laboratories, most assessments of chromosomal DNA is done by PCR-based technologies. These include monoplex or multiplex PCR, SNP arrays, analysis and real-time PCR, ddPCR and next-generation sequencing (NGS). These latter techniques use nanogram amounts of DNA per reaction. Regardless of the system chosen, Promega genomic DNA purification kits provide the required yields of high-quality DNA with minimal contaminants.

Manual Purification Systems

Solution-Based Systems

Promega offers genomic DNA isolation systems based on sample lysis by detergents and purification by various methods. These include both membrane-based systems (e.g., the single-column Wizard® SV Genomic DNA Purification System (Cat.# A2360, A2361) or the high-throughput, 96-well Wizard® SV 96 Genomic DNA Purification System (Cat.# A2370, A2371) and easily automated paramagnetic silica systems. All of these systems purify genomic DNA that is amenable for use in many downstream applications.

The Wizard® Genomic DNA Purification Kit (Cat.# A1120, A1125, A1620) is both a versatile and scalable system for isolating genomic DNA using a precipitation-based method. With this system alone, chromosomal DNA can be isolated from whole blood (5), plant leaf (6), Gram-positive (7) and Gram-negative bacteria (8), mouse tail (9) and yeast (10). Additional sample types like fungus (11), infected frog tissues embedded in paraffin (12), saliva (13) and flour beetles (14) have also been used successfully.

Not only is this genomic purification system successful with many sample types, it is also easily scaled for the quantity of starting material by adjusting reagent volumes to accommodate your needs.

Column-Based Systems

Traditional Column-Based Systems

For single-column isolation, the Wizard® SV Genomic DNA Purification System provides a fast, simple technique for the preparation of purified and intact DNA from mouse tails, tissues and cultured cells in as little as 20 minutes, depending on the number of samples processed (up to 24 by centrifugation, depending on the rotor size, or up to 20 by vacuum). A vacuum manifold or a microcentrifuge is used for sample processing. With some modifications, whole blood can also be used with this isolation system (15). This is a silica membrane-based system, meaning there are limitations to the amount of material that can be loaded onto a single SV column up to 20mg of tissue (mouse tail or animal tissue) or between 1 × 10 4 and 5 × 10 6 tissue culture cells can be processed per purification. With more sample, the prepared lysate may need to be split among two or more columns to avoid clogging.

Figure 2. Amplification of genomic DNA isolated from various tissue sources using the Wizard® SV Genomic DNA Purification System. One microliter of purified genomic DNA was amplified using PCR Master Mix (Cat.# M7502) and mouse-specific IL-1&beta primers (1.2kb product). Reactions with Mouse Genomic DNA (Cat.# G3091 +C) and without DNA (&ndashC) were performed as positive and negative controls, respectively. Thermal cycling conditions were: one cycle of 3 minutes at 95°C followed by 30 cycles of: 95°C for 30 seconds, 60°C for 1 minute, 70°C for 1 minute and 30 seconds final extension at 70°C for 7 minutes 4°C soak. All lanes contained 10µl of reaction product separated on a 1% agarose gel. PCR products were visualized by ethidium bromide staining. &ldquoSpin&rdquo and &ldquoVacuum&rdquo designations indicate the protocol used for genomic DNA isolation.

The genomic DNA isolated with the Wizard® SV Genomic DNA Purification System is of high quality and performs well in agarose gel analysis, restriction enzyme digestions and PCR analysis as seen in Figure 2. Table 1 provides typical yields of genomic DNA purified from a variety of sources.

Table 1. Typical Genomic DNA Yield From Various Tissues using the Wizard® SV Genomic DNA Purification System.

Sample Amount Average Yield
Tail Clipping 20mg 20µg
Liver 20mg 15µg
Heart 20mg 10µg
Brain 20mg 6µg
CHO cells 1 × 10 6 5µg
NIH/3T3 cells 1 × 10 6 9µg
293 cells 1 × 10 6 8µg

Researchers have used this simple and rapid system for many additional sample types and applications including mosquitoes (16), mammary stem cells (17), Bacillus subtilis (18), Escherichia coli (19), the larval form of the Schistosoma mansoni parasite (20) and viral DNA from Kaposi&rsquos sarcoma herpes virus-infected BC3 cells (21).

For high-throughput, 96-well isolation, the Wizard® SV 96 Genomic DNA Purification System is available. Amplifiable genomic DNA can be isolated from up to 5 × 10 6 cells, 20mg of tissue or up to 1.2cm of a mouse tail tip without centrifugation of the lysate prior to purification.

This multiwell system requires a vacuum manifold (Vac-Man® 96 Vacuum Manifold, Cat.# A2291) and a vacuum pump capable of generating 15&ndash20 inches of mercury or the equivalent. Genomic DNA was isolated from three different source types then used in a monoplex PCR and run on an agarose gel as shown in Figure 3. Figure 4 compares the yield from the three Wizard® SV Genomic DNA purification methods (96-well plate, vacuum and centrifugation).

Figure 3. Agarose gel electrophoresis of PCR products amplified from 1µl of mouse tail, CHO cells and tomato leaf sample genomic DNA isolated using the Wizard® SV 96 Genomic DNA Purification System. A total of 10µl of PCR product is visualized on a 1.5% agarose gel stained with ethidium bromide. Panel A. IL-1&beta (1.2kb) amplified from mouse tail. Panel B. &beta-actin (250bp) amplified from CHO cells. Panel C. Chloroplast DNA (600bp) amplified from tomato leaf. Lane M, 1kb DNA Ladder (Cat.# G5711).

Figure 4. Comparison of DNA yields using the Wizard® SV and SV 96 Genomic DNA Purification Systems. Average yield of genomic DNA in micrograms purified from 20mg mouse tail clippings. The average A260/A280 ratios are: SV 96, 1.7 ± 0.08 SV vacuum method, 1.7 ± 0.14 SV spin method, 1.7 ± 0.14.

High-Performance Column-Based Systems

We offer two different ReliaPrep&trade gDNA Miniprep Systems that purify genomic DNA using a cellulose column-based method: ReliaPrep&trade Blood gDNA Miniprep System (Cat.# A5081, A5082) and ReliaPrep&trade gDNA Tissue Miniprep System (Cat.# A2051, A2052). Both are ready-to-use systems that obtain intact genomic DNA without using ethanol washes or precipitations. The ReliaPrep&trade Blood gDNA Miniprep System processes 200&mul of blood or body fluid, either fresh or frozen, in less than 40 minutes. Yields from blood are typically 4&ndash10&mug, depending on the white blood cell count. Up to 25mg of tissue, a buccal (cheek) swab or a 1cm mouse tail can be processed with the ReliaPrep&trade gDNA Tissue Miniprep System and the eluted DNA recovered in 30 minutes or less. The purified DNA can be eluted in as little as 50µl and is suitable for use in downstream applications such as RT-qPCR.

Figure 5. The yield of genomic DNA from the ReliaPrep&trade Blood gDNA Miniprep System varies with white blood cell count. Whole blood was obtained from several individuals, and white cell counts were determined using a hemocytometer. Two hundred microliters of blood was used for genomic DNA purification (n = 3 or 4), and the amount of isolated gDNA was quantitated by absorbance spectroscopy.

Figure 6. Comparison of elution volume with concentration, yield and purity. Aliquots of blood (200&mul) were processed using the ReliaPrep&trade Blood gDNA Miniprep System (n = 4) and eluted with 30&ndash200&mul of Nuclease-Free Water. Concentration (Panel A), total yield (Panel B) and purity (Panel C) were assessed using absorbance spectroscopy. Yield decreased slightly with decreases in elution volume, while concentration increased. Purity as measured by optical density ratios remained constant.

Automated Systems for DNA Purification

As laboratories try to improve productivity for research, diagnostics and applied testing, the need has increased for easy-to-use, low- to moderate-throughput automation of purification processes. Automation eliminates the hands-on time and labor of manual purification, giving you more time and energy to focus on your research.

Cartridge-Based Systems

Traditionally, automation refers to the use of large, specialized and costly equipment that requires extensive training to operate and maintain. Promega has developed the Maxwell® Systems, which provide flexible, reliable, compact and easy-to-use alternatives to traditional automated systems.

The Maxwell® Systems are designed for efficient, automated purification from a wide range of sample types (see Table 2). Maxwell® Instruments are supplied with preprogrammed automated purification methods, and can process up to 48 samples in as little as 30–40 minutes (depending on instrument, sample type and method). The purified concentrated DNA or RNA are high quality and high yield, making them compatible with many common downstream applications, including qPCR, ddPCR, genotyping, sequencing and NGS.

Figure 7. The Maxwell® RSC (left) and Maxwell® RSC 48 (right).

Table 2. DNA yield from various sample types after purification using the Maxwell® RSC Instrument and DNA Purification Kits.

Up to 50mg of liver tissue
Up to 50mg of lung tissue

Maxwell® Kits offer predispensed reagent cartridges for purification of genomic DNA, RNA and Total Nucleic Acid. Application and sample type-focused kits make the Maxwell® Instruments a versatile extraction instrument for laboratories that may work with one or all of these different applications.

Figure 8. The Maxwell® RSC DNA or RNA extraction methods start with cartridges prefilled with purification reagents and paramagnetic particles, ready for your samples. After sample addition, the Maxwell® RSC moves the paramagnetic particles and associated nucleic acids through multiple steps ultimately yielding highly pure RNA or DNA in 30–100µl.

The Maxwell® Systems purify samples using paramagnetic particles (PMPs), which provide a mobile solid phase that optimizes sample capture, washing and elution of the nucleic acid. The Maxwell® Instruments are magnetic-particle-handling instruments that efficiently bind nucleic acids to the paramagnetic particle in the first well of a prefilled cartridge. The samples are processed through a series of washes before the nucleic acid is eluted. The systematic magnetic particle-based methodology used by the Maxwell® Instruments avoid common problems associated with automated liquid handler-based purification systems, such as clogged tips or partial reagent transfers, which can result in suboptimal purification processing.

The benchtop-compact Maxwell® Instruments are easy to set up and require no special training for use. Optimized automated methods are preloaded, the prefilled reagent cartridges are snapped into place, your sample is added and you select "Start" to begin the appropriate method. A full list of nucleic acid extraction kits is available here.

Several Maxwell® Instrument reagent kits are available and allow optimal extraction from a variety of sample types, including blood, serum and plasma, formalin-fixed, paraffin-embedded (FFPE) tissue, bacteria, plant, food and animal tissue.

Maxwell® HT Systems allow purification of DNA or RNA at scale on any laboratory liquid handler in 24- or 96-well SLAS format. Maxwell® purification chemistries use novel magnetic particle-based solutions that naturally decrease contamination carryover.

In addition to trusted chemistry, you&rsquoll gain expert support to get started with automation or optimize your current HT workflow. Our team of automation experts can offer assistance with most of the leading laboratory automation providers in the world and help you develop and implement an automated nucleic acid purification solution customized to the needs of your laboratory.

Genomic DNA Extraction Kits

Looking for extraction options by sample scale or type? Explore our DNA extraction portfolio to discover the right solution for your purification needs.

Scalable Automation Solutions

The Maxwell® RSC Instruments provide a compact, automated nucleic acid purification platform that processes up to 16 (Maxwell ® RSC) or up to 48 (Maxwell ® RSC 48) samples simultaneously.

High-throughput Purification Chemistries and Automation Support

Maxwell® HT chemistries allow automation of nucleic acid purification on liquid handlers. Our team of automation experts offer assistance to help develop and implement an automated nucleic acid purification solution customized to the needs of your laboratory.

High-Throughput Systems for Genomic DNA Isolation

Promega offers several automated high-throughput options to isolate genomic DNA isolation from blood samples. Some laboratories, such as biobanks, have a desire to isolate DNA from large amounts of starting material (e.g., 10ml of blood). The ReliaPrep &trade Large Volume HT gDNA Isolation System (Cat.# A2751) provides an effective means for isolation of genomic DNA derived from blood fractions derived from 2.5&ndash10ml samples of whole blood. This chemistry can be automated onto liquid handlers by using a Promega HSM device, which enable processing of purification reactions in 50ml conical tubes.

Liquid level sensing and instrument operating software scale the chemistry to sample input volume for each individual sample, reducing reagent waste and expense. The automated system can also process sample in 14ml tubes using the Low Volume Adapter XAT1020 (LVA and Methods) which enables processing samples from 0.25&ndash3ml.

There are no tedious centrifugation steps or hazardous chemicals, which are inherently handling workstation, offering walkaway purification of genomic DNA from whole blood, regardless of sample storage or shipping conditions.

Figure 9. DNA was isolated from whole blood via three methods, separated by CHEF gel electrophoresis and visualized by ethidium bromide staining. DNA isolated using the ReliaPrep&trade Large Volume HT gDNA Isolation System provided DNA with a size range of 20–125kb precipitation-based purification isolated DNA with a size range of 20–200kb while column-based methods demonstrated gDNA with a size of 20–75kb.

There is an option for low-throughput isolation of gDNA from up to 32 samples at one time when the Heater Shaker Magnet Instrument (HSM 2.0 Cat.# A2715) is used on a bench versus integrated on a liquid handler where the user dispenses and aspirates reagents from the samples as directed by the software on a computer screen. The preprogrammed methods control the heating, shaking, magnetization and timing of the steps required for the semi-automated purification.

In addition to whole blood, a variety of other sample types can also be processed, including stabilized saliva, buccal wash samples, blood fractions, buffy coats, red cell pellets and all cell pellets. For fully automated purification, the HSM 2.0 Instrument can be integrated with a robotic liquid-handling workstation.

Automating reagents onto instrumentation requires a carefully planned and executed approach. Collaborating with Promega gives you access to scientists who have designed automated purification for hundreds of labs, across a wide range of sample types.

Automating reagents onto instrumentation requires a carefully planned and executed approach. Collaborating with Promega gives you access to scientists who have designed automated purification for hundreds of labs, across a wide range of sample types.

Figure 10. Automated DNA yields for blood fractions. DNA yield is linear with respect to original volumes of blood. Panel A. DNA yields as determined by NanoDrop spectrophotometer. Panel B. DNA yields as determined using the QuantiFluor&trade dsDNA System. All samples were prepared from a single donor. Manual samples were processed using the Wizard® Genomic DNA Purification Kit. Each point is the mean of n=4 values with error bars of 1 standard deviation.

Custom HT Nucleic Acid Purification

Implementing automated nucleic acid purification technologies onto your high-throughput workflow can be challenging and time-consuming. Our Field Support Scientists can provide the support you need to get started.

Selected DNA Purification Kits by Sample Type

Learn more about some of our specialized kits below, and explore the breadth of our portfolio and compare our DNA extraction kits with the help of our product comparison page to discover the right solution for your DNA purification needs.

Fixed-Tissue Genomic DNA Isolation

The MagneSil® Genomic, Fixed-Tissue System (Cat.# MD1490), provides a fast, simple technique for the preparation of genomic DNA from formalin-fixed, paraffin-embedded tissue. After an overnight Proteinase K digestion, genomic DNA can be manually purified from FFPE thin tissue sections in less than an hour. Amplifiable genomic DNA can be isolated from 10μm sections without centrifugation of the lysate prior to purification. Up to 12 samples can be processed in the manual format using a MagneSphere® Technology Magnetic Separation Stand (Cat.# Z5332, Z5342).

Figure 11. Analysis of DNA purified from paraffin-embedded, formalin-fixed 10µm thin sections using the MagneSil® Genomic, Fixed Tissue System. Purified DNA was amplified, and the amplification products were analyzed on an ABI PRISM® 310 or 3100 genetic analyzer. Panel A. Amplification with a set of 16 fluorescently labeled primers. Amplification products range in size from 104 to 420 bases. Panel B. A 972-base fragment amplified using an amelogenin primer set. Panel C. A 1.8kb fragment amplified from the Adenomatosis polyposis coli (APC) gene. Increasing the extension time during amplification may help to balance yields between small and large amplification products and increase yields for large amplification products. Results will vary depending on the degree of cross-linking due to formalin fixation.

One advantage this system has over other purification methods, such as phenol:chloroform extraction, is its ability to remove most inhibitors of amplification, including very small fragments of DNA. Tissue that has been stored in formalin for extended periods of time may be too cross-linked or too degraded to perform well as a template for amplification. Figure 11 shows an amplification of 16 short tandem repeat (STR) loci and demonstrates how well the isolated DNA can work in multiplex PCR using the PowerPlex® 16 HS System (Cat.# DC2101, DC2100).

The Maxwell® RSC FFPE Plus DNA Kit (Cat.# AS1720) is an automated method for purifying up to 48 samples of one to ten 5μm sections of FFPE tissue samples on the Maxwell® RSC Instrument (Cat.# AS4500 1–16 cartridges per run) or Maxwell® RSC 48 Instrument (Cat.# AS8500 1–48 samples per run). The FFPE Plus chemistry is designed to provide high yield of DNA from FFPE when measured by spectroscopy that is suitable for amplification applications including qPCR, multiplex PCR and NGS. The protocol provides flexibility with either a 1-hour quick deparaffinization or 24-hour overnight protocol to fit your work flow needs.

The Maxwell® RSC DNA FFPE chemistry is Promega’s latest FFPE technology and has been designed to provide highly amplifiable DNA. Save time and labor by utilizing either FFPE chemistry with the Maxwell® Instruments, and avoid exposure to hazardous xylene utilized in other FFPE purification products. Our quality testing has also demonstrated virtually no PCR inhibitors in purified DNA samples, making your PCR and other downstream applications a breeze.

Utilizing the same chemistry as the Maxwell® RSC FFPE DNA, the Maxwell® HT DNA FFPE Isolation System (Cat.# A6372) provides a simple and reliable method for high-throughput, rapid isolation of genomic DNA from FFPE tissue samples. The system does not require an organic solvent, making it safe and convenient to use, and the purified DNA can be used directly in a variety of downstream applications, including PCR and NGS.

The Maxwell® HT DNA FFPE Isolation System purifies nucleic acid using paramagnetic particles, which provide a mobile solid phase to optimize binding, washing and purification of gDNA. The use of paramagnetic particles for DNA isolation eliminates the need for centrifugation or vacuum manifolds, making the system suitable for full automation.

As FFPE samples can have widely varying quality due to the nature of the sample fixation and embedding process, QC of samples can be an important part of the FFPE workflow.

Figure 12. Comparative data of the Maxwell® RSC DNA FFPE chemistry versus the Maxwell® RSC FFPE Plus DNA chemistry. The Maxwell® RSC FFPE Plus DNA method has been observed to produce more yield by absorbance and fluorescence, while the Maxwell® RSC DNA FFPE method produces more yield by PCR.

Spectrophotometry is a common way to evaluate the quality of extracted DNA and RNA. Most laboratories have a NanoDrop Microvolume Spectrophotometer (or similar device) and they are incredibly easy to use. Pipette 1-2µl of sample, select “Analyze” and the instrument provides a read out of concentration and purity via A260/A280 and A260/A230 ratios in just a few seconds. These devices have revolutionized routine sample quantitation in the lab, but is it the best method for assessing FFPE samples? There are two main considerations when using a NanoDrop: sensitivity and integrity. FFPE samples can have a wide-ranging yield of DNA or RNA often as little as 10ng or less in a volume ranging from 10µl to 100µl from an extraction. This can result in sample concentrations below the NanoDrop’s linear range. In addition, as a spectrophotometer, it does not differentiate between RNA, DNA or free nucleotides, which can result in dramatic inaccuracies in DNA/RNA concentration measurements. Finally, there is no way to determine if a sample is accessible to downstream enzymatic assays since it cannot detect the presence or absence of crosslinks (or other damage) within a sample.

Dye-Based Quantitation like the Promega QuantiFluor® dsDNA System (Cat.# E2670, E2671), provides a rapid and significantly more sensitive method to quantitate dsDNA or RNA compared to absorbance spectroscopy. This method provides a broadly useful estimate of concentration. When considering FFPE samples, it is important to note that dye-based quantitation does not estimate the integrity of the DNA/RNA or the extent of cross-linking in the sample, which could affect success in downstream assays.

Sizing Assays (e.g., agarose gel, Tape station, fragment analyzer, DV200) can provide an estimate of concentration and—more importantly—information on the size distribution of the fragments in the sample. FFPE-derived DNA, due to the fixation process, can be significantly fragmented compared to DNA from freshly frozen tissue. Below is a fragment analyzer trace (Figure 13) and associated DV200 scores (Table 3) of DNA isolated from FFPE sections using five different purification methods. While the sizing traces do assess the distribution of DNA size purified, it does not measure the degree of cross-linking within the sample or the presence of inhibitors.

Figure 13. Fragment analyzer trace of DNA isolated from FFPE sections using five different purification methods.

Table 3. DV200 scores of DNA isolated from FFPE sections using five different purification methods in fragment analyzer trace (Figure 13).

Method 1 (Light Green) 2 (Blue) 3 (Red) 4 (Orange) 5 (Green)
DV200 71.8 69.9 70.1 58.7 80.5

For example, when the same samples were quantitated by qPCR assays of various targets and fragment sizes, the yield by qPCR does not correlate well with the DV200 scores. In fact, in this example, the samples with the lowest DV200 scores had the greatest yield by qPCR (Figure 14).

Figure 14. qPCR yields of DNA isolated from FFPE sections. The same samples of DNA isolated by five different purification methods in the fragment analyzer trace and DV200 table above were quantitated by qPCR assays of various targets and fragment sizes.

While there are general trends, the DV200 score does not necessarily correlate with success in downstream assays such as qPCR.

qPCR has several advantages for the quantitation of FFPE samples. First, qPCR can be very sensitive, requiring only a small amount of sample and detecting pg/µl amounts of DNA. In terms of sensitivity in nucleic acid detection, it is surpassed only by ddPCR. qPCR can also provide a measure of how degraded or crosslinked a DNA sample may be since nucleic acid must be a suitable substrate for a DNA polymerase for a signal to be generated. Absorbance may not represent the sample suitable for the downstream assay because it will detect DNA, fragmented DNA and nucleotides. Finally, most qPCR QC assays, such as the ProNex® DNA QC Assay (Cat.# NG1004, NG1005) provide internal controls which are used to detect the presence of inhibitors in the sample prior to attempting a more expensive assay. This can help you assess not only the integrity of the nucleic acids, but also the likelihood of an amplification-based assay to be successful.

NGS is another assay used by some labs to QC their samples. There are several reasons for this. Some labs are trying to get as much data as possible from very precious samples, in which case any sequence information may be worth the expense and risk of failed sequencing runs. As a QC test, NGS may provide a lot of information, but it is expensive and can require large amounts of sample and time. Some labs run low pass NGS, which uses highly-multiplexed samples to lower the cost per sample to determine if it is worth the time and resources to sequence deeper. Most sequencing and purification providers recommend qPCR assays to quantitate FFPE DNA, as all NGS workflows depend primarily on the success of enzymatic amplification steps to obtain sequencing-ready DNA as part of library preparation steps.

Table 4. Comparative Pros and Cons of Various QC Assays.

Method Speed Sensitivity Quantitative? Measure Purity? Assess size of NA? Detect Cross- linking? Cost
Spectrophotometry (NanoDrop) +++ + Semi - quantitative + - - $
Dye-Based Quantitation +++ ++ Y - - - $
DV200 ++ + Semi - quantitative - +* - $$
Gel Electrophoresis ++ +/- Semi - quantitative - +* - $
qPCR ++ +++ Y +* + + $
NGS + Y + ++ + $$$

Plant Genomic DNA Isolation

The Wizard® Magnetic 96 DNA Plant System (Cat.# FF3760, FF3761) is designed for manual or automated 96-well purification of DNA from plant leaf and seed tissue. The Wizard® Magnetic 96 DNA Plant System has been validated with corn and tomato leaf as well as with canola and sunflower seeds. The DNA purified from these samples can be used in PCR and other more demanding applications, such as RAPD analysis. Since plant materials can be particularly challenging to lyse, especially when working with tough or woody tissues, additional required equipment includes not only a magnet (MagnaBot® FLEX 96 Magnetic Separation Device, Cat.# VA1920) but also a device capable of breaking up seed or leaf material (e.g., Geno/Grinder® 2000 from SPEX CertiPrep, Inc.).

The yield depends on the source material and how well the seeds or leaf disks are pulverized prior to the genomic DNA isolation. Yield may range from 10–100ng from a single 8mm leaf punch. To increase the yield from the Wizard® Magnetic 96 DNA Plant System, a scale up in volume with up to 5 leaf punches can be used [as demonstrated in Promega Notes 79]. The potential scale-up is limited by the volume in a deep-well, 96-well plate.

Another automated option we have to meet your plant DNA extraction needs, is the Maxwell® RSC Plant DNA Kit (Cat.# AS1490). The Maxwell® RSC Plant DNA Kit is used with the Maxwell® RSC and RSC 48 Instruments to provide an easy method for efficient, automated purification of genomic DNA (gDNA) from a range of plant tissue samples, including corn, soybean and Arabidopsis. The Instruments are supplied with preprogrammed purification methods and uses predispensed reagent cartridges, maximizing simplicity and convenience.

Using this system, DNA can be purified from plant samples in under 60 minutes with minimal preprocessing and no organic extractions. Automated purification results in consistent purification, with less variability than traditional DNA extraction methods such as CTAB and spin-columns. The resulting purified DNA is ready to use in downstream applications, including amplification assays.

Serum-Plasma Genomic DNA Isolation

For high quality, purified cell-free DNA from plasma samples, we offer the Maxwell® RSC ccfDNA Plasma Kit (Cat.# AS1480). Utilizing the simple three-step protocol, the Maxwell® RSC Instrument can process 1 to 16 samples, and the Maxwell® RSC 48 Instrument can process 1 to 48 samples. Simply add 0.2–1.0ml of plasma to the prepared cartridges and select Start, no preprocessing of samples required. In approximately 70 minutes, you will have high yields of amplifiable DNA that is ready to be used in downstream assays including qPCR, NGS and digital PCR.

As a magnetic particle mover, not a liquid handler, the Maxwell® RSC additionally offers several advantages over other automated systems. Since no liquid handling or splashing occurs during sample processing, there is minimal risk of sample cross-contamination. It also eliminates the worry of potential clogs and inevitable system breakdowns that follow, ensuring a smooth workflow with fewer disruptions.

Bacterial Genomic DNA Isolation

If you need to make quick decisions about potential food contamination and spoilage, the Maxwell® RSC PureFood Pathogen Kit (Cat.# AS1660) offers a simple automated protocol with minimal hands-on steps. The kit effectively eliminates laborious sample preprocessing steps such as enzymatic pretreatment, as it works with inhibiting sample types and also has the ability to lyse both Gram+ or Gram– bacteria.

By coupling the high-performance Maxwell® chemistries with the trusted benchtop Maxwell® RSC instruments, you will be able to effectively purify bacterial DNA from up to 48 food samples in as little as 40 minutes. Once extracted, the resulting DNA is ready for advanced downstream molecular analyses, including serotyping, NGS and identification of spoilage organisms.

This method can be utilized for both raw and processed food and has successfully been used to isolate pathogen DNA from a wide variety of food samples, including E. coli 0157:H7 from uncooked beef, Salmonella enterica from uncooked chicken and Listeria monocytogenes from whole milk. Figure 15 below highlights a comparison of total DNA versus E. coli 0157:H7 DNA extracted from cilantro samples that were spiked with the E. coli 0157:H7 bacteria.

Figure 15. Comparison of total DNA and E. coli 0157:H7 DNA extracted from cilantro samples spiked with the indicated amounts of E. coli 0157:H7 bacteria. The total DNA concentration was assessed using the QuantiFluor® ONE dsDNA System.

Buffy Coat Genomic DNA Isolation

The Maxwell® RSC Buffy Coat DNA Kit (Cat.# AS1540) provides a simple, automated method of genomic DNA extraction using the convenient, prefilled cartridge format of the Maxwell® RSC Instrument. The kit contains all the reagents you need for optimal DNA extraction, and is compatible with blood stored in EDTA, heparin and citrate anticoagulants. Avoid the tedious and time-consuming hassle of preprocessing samples, simply add 50–250μl of your sample directly into well #1 of the cartridges. Your purified DNA is ready for analysis in about 50 minutes, and can be used directly in various downstream applications, such as agarose gel electrophoresis.

Food Genomic DNA Isolation

Food and plant materials often provide the greatest challenge for cell lysis and intact DNA extraction, due to the lysis conditions required to liberate the nucleic acid and the processing of plant materials into comestibles.

Another specialized genomic DNA isolation system is the Wizard® Magnetic DNA Purification System for Food (Cat.# FF3750, FF3751). This convenient protocol is designed for the manual purification of DNA from a variety of food samples including corn seeds, cornmeal, soybeans, soy flour and soy milk, generating results in one-third of the time of traditional methods. In addition, DNA can be purified from processed food such as corn chips, chocolate and chocolate-containing foods, lecithin and vegetable oils if used with the appropriate optimized protocols.

The DNA purified from many of these samples can be used in PCR-based testing for Genetically Modified Organism (GMO) DNA sequences, such as by quantitative analysis using TaqMan® assays. As with all isolation systems using the MagneSil® PMPs, a magnetic separation stand is needed and enables processing of up to 12 samples per batch. With samples containing highly processed food, the genomic DNA isolated will be fragmented and better suited for analysis using amplification rather than a Southern blot. The yield of DNA from this system will vary depending on source type and extent of food processing.

The Maxwell® RSC PureFood GMO and Authentication Kit (Cat.# AS1600) provides an easy and automated method for efficient purification of DNA for PCR-based food and ingredient authentication. The Kit is used with the Maxwell® RSC and RSC 48 Instruments and can purify DNA from raw and processed food samples, including corn, soybeans, canola, ground beef and ground pork.

100 minute protocol requires only 30 minutes of hands-on time, effectively achieving not only faster results with walk-away automation, but also freeing up laboratory resources for higher value activities. The purified DNA extracted using the PureFood Kit is ready to be used for several applications, including real-time PCR, gel electrophoresis, next-generation and Sanger sequencing and microarrays.

Nucleic Acid Purification Protocols for Plant & Food Sample Types

Explore our collection of protocols for manual and automated DNA or RNA extraction from a variety of food and plant samples.


  • A series of lab exercises giving instructions for the extraction of DNA from several different starting materials. The exercise is designed for the 6-12 grade level.

The following resources were originally accessed through the BioSciEd Net (BEN) digital resources collection, which is the National Science Digital Library (NSDL) Pathway for biological sciences education. For more teaching resources, please visit BEN to use their searchable database. BEN is free to use, but requires registration.

    - This lab, from AccessExcellence enables students to work with DNA concretely by easily isolating chromosomal DNA using the same basic tools and methods that scientists use. - this Science NetLinks website provides lesson plans that develop understanding of DNA by modeling the process of DNA extraction.
  • [link https://web.archive.org/web/20190222033127/http://www.apsnet.org/edcenter/K-12/TeachersGuide/DNA_Easy/Pages/default.aspx 'DNA the Easy Way (and Gram Stain Without the Mess)'] - This resource, by the American Phytopathological Society, is a short laboratory exercise that teaches students the procedures of DNA isolation from bacterial cells. In addition, students learn how to determine the Gram-stain reaction of bacterial isolates. : This Access Excellence resource provides a laboratory activity where students use DNA fingerprinting analysis to determine the perpetrator of a fictitious crime. - This resource requires you to log in to BEN to view (which requires a subscription to BEN, which is free). This PDF document offers a detailed manual of protocols and instructional information for carrying out an undergraduate laboratory exercise in molecular biology and cenetics, in which students use polymerase chain reaction to create DNA fingerprints from their own hair. It includes student outlines, instructor's notes, and suggested questions for laboratory reports.

About

Reuse

Material on this page is offered under a Creative Commons license unless otherwise noted below.


DNA purification by isopropanol precipitation

Introduction

Isopropanol precipitation is a simple method for DNA purification. Here, a protocol which I adopted in my former experiments is introduced. Alternatively, DNA-containing solution can be mixed with the same volume of isopropanol, then treated just like the protocol for ethanol precipitation. We have also tried DNA purification by &lsquoCTAB precipitation&rsquo method, but this trial was far from successful [1].

Reagent

High-Salt Solution for Precipitation (Takara, Kusatsu, Japan).

Protocol

Be careful so as not to directly touch isopropanol with your skin.

Add half volume (of DNA solution) of High-Salt Solution for Precipitation and mix.

Add the same volume (as High-Salt Solution for Precipitation) of isopropanol and mix. Place at room temperature for 10 min. Centrifuge at the maximum speed for 10 min at 4°C. Discard supernatant.

Add 1 mL of 70% ethanol. Place at &minus80°C for 15 min.

Thaw out sample and immediately proceed to centrifugation at the maximum speed for 5 min at 4°C. Discard all supernatant and dry.


Purification and concentration of DNA from aqueous solutions

This unit presents basic procedures for manipulating solutions of single- or double-stranded DNA through purification and concentration steps. The Basic Protocol, using phenol extraction and ethanol precipitation, is appropriate for the purification of DNA from small volumes (<0.4 ml) at concentrations <1 mg/ml. Isopropanol may also be used to precipitate DNA, as described in an alternate protocol. Three support protocols outline methods to buffer the phenol used in extractions, concentrate DNA using butanol, and extract residual organic solvents with ether. An alternative to these methods is nucleic acid purification using glass beads, and is described here. These protocol may also be used for purifying RNA. The final protocols provide modifications to the Basic Protocol that are used for concentrating RNA and extracting and precipitating DNA from larger volumes and from dilute solutions, and for removing ow-molecular-weight oligonucleotides and triphosphates.


Make a chart (with diagrammatic representation) showing a restriction enzyme, the substrate DNA on which it acts, the site at which it cuts DNA and the product it produces.

â–² Fig. 7.3. EcoRI cuts the DNA between bases G and A only when the sequence GAATTC is present in the DNA.


DNA Extraction Protocol for Plants with High Levels of Secondary Metabolites and Polysaccharides without Using Liquid Nitrogen and Phenol

Mangroves and salt marsh species are known to synthesize a wide spectrum of polysaccharides and polyphenols including flavonoids and other secondary metabolites which interfere with the extraction of pure genomic DNA. Although a plethora of plant DNA isolation protocols exist, extracting DNA from mangroves and salt marsh species is a challenging task. This study describes a rapid and reliable cetyl trimethylammonium bromide (CTAB) protocol suited specifically for extracting DNA from plants which are rich in polysaccharides and secondary metabolites, and the protocol also excludes the use of expensive liquid nitrogen and toxic phenols. Purity of extracted DNA was excellent as evident by A260/A280 ratio ranging from 1.78 to 1.84 and A260/A230 ratio was >2, which also suggested that the preparations were sufficiently free of proteins and polyphenolics/polysaccharide compounds. DNA concentration ranged from 8.8 to 9.9 μg μL −1 . The extracted DNA was amenable to RAPD, restriction digestion, and PCR amplification of plant barcode genes (matK and rbcl). The optimized method is suitable for both dry and fresh leaves. The success of this method in obtaining high-quality genomic DNA demonstrated the broad applicability of this method.

1. Introduction

The isolation of pure, intact, and high-quality DNA is very crucial for any molecular studies [1]. However, DNA isolation from plants is usually compromised by excessive contamination by secondary metabolites. The DNA isolation methods need to be adjusted to each plant species and even to each plant tissue because of the presence of these metabolites, unlike animals and microbes [2]. The search for a more efficient means of extracting DNA of both higher quality and yield has led to the development of several protocols for isolating DNA from plants containing high levels of secondary metabolites [3–7]. The mangroves and salt marsh are specially adapted to harsh environment such as marshy anoxic anaerobic soil and fluctuating salinity of the water bodies [8]. To avoid these stress conditions mangroves and salt marsh plants synthesize high amounts of polysaccharides, polyphenols, and other secondary metabolites such as alkaloids and flavanoids which impede DNA extraction [9, 10].

Many factors can cause shearing of DNA during extraction. Degradation of DNA due to endonucleases is one such problem encountered in the isolation and purification of high molecular weight DNA from plant, which directly or indirectly interfere with the enzymatic reactions [11]. Polysaccharides may be particularly problematic when present in DNA samples, as their presence may also inhibit enzymatic activity. Presence of polysaccharides has been shown to inhibit Taq polymerase activity [12] and restriction enzyme activity [13]. The presence of polysaccharides in the DNA sample is characterized by formation of a highly viscous solution [14]. The oxidized form of polyphenols covalently binds to DNA giving a brown colour and reduces maintenance time, making it useless for molecular studies [15].

Apart from traditional extraction approaches, several commercial kits are also accessible to extract genomic DNA from plants with sufficient quality [16]. For extracting genomic DNA an initial mechanical grinding of the leaf sample is carried out in the presence of liquid nitrogen, where the ultimate aim is to access the nuclear material without degradation. Numerous DNA isolation protocols use phenol to separate cellular molecules and debris from the DNA which is toxic, hazardous, expensive, and require special containment facilities to maximize personnel safety and minimize environmental concerns. However, the convenience provided by the above-mentioned methods may be cost prohibitive when considering experiments with limited financial resources.

Several researchers have attempted to eliminate the use of hazardous chemicals, expensive kits, equipment, and labour-intensive steps for high throughput DNA extraction. However, these methods do have demerits such as limited shelf life, low purity, low recovery, and poor amplification [17, 18]. Mostly the DNA extraction protocols recommend fresh leaf samples for genomic DNA isolation, but it seems impractical when the samples are collected from remote and rare locations. These situations necessitate the development of the protocols for isolating DNA from dried leaf samples. The objective of this study was to develop a simple method to isolate DNA in an open laboratory environment, a method that eliminates the need to use liquid nitrogen and toxic phenol. The resulting optimized CTAB (Cetyl trimethylammonium bromide) protocol enables the isolation of high quality genomic DNA amenable to RAPD (Random amplified Polymorphic DNA), restriction digestion, and amplification of plant barcode genes (matK and rbcl) with reduced cost and health concerns.

2. Materials and Method

2.1. Plant Samples for DNA Isolation

Young, tender, and unbruised leaves of mangroves (Rhizophora mucronata, Rhizophora apiculata, Aegiceras corniculatum, Lumnitzera racemosa, Lumnitzera littorea, Bruguiera gymnorrhiza, Bruguiera cylindrica, Scyphiphora hydrophyllacea, Avicennia marina, Avicennia officinalis, and Xylocarpus mekongensis) and salt marsh (Suaeda maritima and Sesuvium portulacastrum) were collected from Pichavaram Mangrove Forest, Tamil Nadu, India and stored in −80°C until use. The leaves were preferred for DNA extraction due to their continued availability whole year round. A minimum of ten accessions were taken for each genus. Dried leaves of Rhizophora and Avicennia sp. were also taken to scrutinize the applicability of the optimized extraction protocol.

2.2. Extraction Methods

Plant genomic DNA extraction Kit (GeNei), CTAB DNA extraction method by Porebski et al. [4], J. J. Doyle and J. L. Doyle [19], and Saghai-Maroof et al. [20] were employed for extracting DNA from the study plants. Among all the tested protocols, Saghai-Mahroof method yielded convincing results. Therefore, this method was taken and optimized for DNA extraction by varying the concentration of Tris-HCl, NaCl (Sodium Chloride),

-mercaptoethanol, and PVP (PolyVinyl Pyrrolidone).

2.3. Standardized Extraction Method

(i) Preheat suspension buffer (pH 8) containing 50 mM EDTA, 120 mM Tris-HCl, 1 M NaCl, 0.5 M sucrose, 2% Triton-X 100, and 0.2% -mercaptoethanol (to be freshly added just before use) in water bath at 60°C. (ii) Grind −80°C stored leaves (1 g) to fine powder in ice cold condition in the presence of 250 mg PVP (PolyVinyl Pyrrolidone, Mr 10,000) by using pre chilled mortar and pestle (−40°C/−80°C).

Note: To avoid usage of liquid nitrogen, this method is successfully employed. If −80°C is not available, −40°C/−20°C can also be used. Lower the temperature and lower will be the chances of DNA degradation (nuclease activity). Appearance of brown colour indicates DNA degradation. (iii) Transfer the content in 2 mL microcentrifuge tubes and suspend in two volumes of suspension buffer. (iv) Invert and mix gently and incubate at 60°C for 40 min. (v) Centrifuge the suspension at 10,000 rpm for 15 min at room temperature. (vi) Add 1.5 mL of extraction buffer containing 20 mM EDTA, 100 mM Tris-HCl, 1.5 M NaCl, 2% CTAB, 1% -mercaptoethanol and incubate at 60°C for 30 min. (vii) Centrifuge at 12,000 rpm for 15 min at room temperature. (viii) Carefully transfer the aqueous phase into a new tube.

Note: Use wide-bore tips for transferring the aqueous phase to avoid mechanical damage to DNA. (ix) Add double volume of Chloroform: Isoamyl alcohol (24 : 1), and invert gently 15 to 20 times and centrifuge at 12,500 rpm for 15 min.

Note: If the aqueous layer appears translucent, repeat the step until the solution is transparent. (x) Add double volume of chilled isopropanol and keep at −20°C for one hour to precipitate the DNA.

Note: The longer the chilled incubation, the more the precipitation. (xi) Centrifuge at 12,000 rpm for 15 min and discard the supernatant. (xii) To the pellet, add 70% chilled ethanol and spool out the pellet carefully and centrifuge again at 12,000 rpm for 15 min. (xiii) Discard the supernatant and vacuum dry or air dry the pellet at room temperature.

Note: Make sure that there is no residual ethanol, this is very critical especially if the DNA is to be used directly for PCR. Overdrying should also be avoided as it makes the pellet difficult to resuspend. (xiv) Add 100

L of high salt TE buffer (0.5 M NaCl, 10 mM Tris-HCl, 1 mM EDTA (pH 8). (xv) Add 3 L RNase (10 mg/mL) and keep at 37°C for 30 min followed by chloroform: isoamyl alcohol extraction and ethanol precipitation in the presence of 3 M sodium acetate (pH 5.2). (xvi) Spool out the DNA, wash in 70% ethanol, air or vacuum dry. (xvii) Add 30 to 50 L (depending upon the pellet) of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8) to dissolve the precipitate.

Note: Chelator present in TE can affect PCR and restriction digests. DNA in TE should be suitably diluted before use in such reactions. (xviii) Store at −20°C/−40°C till further use.

2.4. Qualitative and Quantitative Analysis of Extracted DNA

The DNA yield was measured by using a UV-Visible spectrophotometer (Perkin Elmer) at 260 nm. DNA purity was determined by calculating the absorbance ratio A260/280. Polysaccharide contamination was assessed by calculating the absorbance ratio A260/230 [21]. For quality and yield assessments, electrophoresis was done of all DNA samples in 0.8% agarose gel, stained with Ethidium Bromide and bands were observed in gel documentation system (Alpha Innotech).

2.5. Random Amplified Polymorphic DNA (RAPD) Study

The PCR amplification reaction was carried out with five random decamer primers (Rpl1 to Rpl5) obtained from GeNei (Bangalore) in a 25 L reaction volume containing 10 mM Tris-HCl, pH 8.3, 2.5 mM MgCl2, 1 mM dNTP mix, 0.2 M of each primer, 1 U of Taq DNA polymerase, and 15 to 40 ng of template DNA. RAPD-PCR was performed in a thermalcycler (Tech Gene) for 40 cycles consisting of denaturation at 94°C for 30 sec, annealing at 45°C for 30 sec, and extension at 72°C for 60 sec. The final extension was carried out at the same temperature for 5 min. The amplified product was checked in 1.5% agarose gel electrophoresis and bands were observed in gel documentation system (Alpha Innotech).

2.6. Restriction Fragment Length Polymorphism (RFLP) Study

The extracted DNA was subjected to RFLP study [22]. Briefly, the reaction mixture was prepared by adding 10 L of extracted DNA, 15 L of 2X assay buffer, 10 L of BSA, and 3 L of restriction enzyme (Bam hI, ECORI and PstI). The vials were incubated at 37°C for 1 hr for complete digestion. The restriction enzyme digested products were visualized through silver staining of the polyacrylamide gel. The gels were fixed in 50 mL of fixing solution (diluted five times with 30.4 mL double-distilled water and 9.6 mL ethanol) for 30 min and silver-impregnated (with 1X staining solution) for another 30 min. This was followed by washing the gels in double-distilled water for 1 to 2 min. After removing the staining solution the gels were then kept in the developing solution in dark for 10 min. When the bands were dark enough, the developing solution was poured out and the stopping and preserving solution was immediately added.

2.7. matK and rbcl Gene Amplification

PCR amplification of matK (trnK-F: gggttgctaactcaatggtagag trnK-R: tgggttgcccggggccgaac) and rbcl (rbcl-F: actgtagtaggtaaacttgaaggtgaacg rbcl-R: gaaccttcctcaaaaaggtctaaggggta) were carried out in 25 L reaction containing 1.0 U Taq DNA polymerase, 1 mM dNTPs-Mix, 1XTaq buffer, 2.5 mM MgCl2, 20 mM of each amplification primer, and 10–50 ng of template DNA in a one-step touchdown PCR-program (1 cycle at 90 sec at 96°C, 60 sec at 50°C, 120 sec at 68°C, 35 cycles at 30 sec at 95°C, 60 sec at 48°C, 120 sec at 68°C, subsequent final elongation of 20 min at 68°C) [23]. Annealing temperature (

) ranged from 47 to 50°C with respect to different plant species. The amplified products were separated by electrophoresis in 1.5% agarose gel buffered with 1X TAE. Gels were stained with ethidium bromide, and bands were observed in gel documentation system (Alpha Innotech).

3. Results and Discussion

Plant genomic DNA extraction Kit (GeNei) did not show promising results for mangroves and salt marsh species as evident by the presence of sticky polysaccharides in the pellet and sheared band in the agarose gel. We encountered many difficulties from the very first step of cell lysis to DNA separation in the supernatant and subsequent reactions when the CTAB DNA extraction method of Porebski et al. [4] and J. J. Doyle and J. L. Doyle [19] was followed. Highly viscous and sticky pellets were difficult to handle and the brownish pellet, indicated contamination by phenolic compounds [24]. The amount of DNA obtained with these protocols was very low, and the quality was also poor for most of the samples. A260/A280 ratio was less than 1.6, that is, below the optimal limit of 1.8 [25] making the DNA nonamenable for molecular studies. But, interestingly the CTAB method described by Saghai-Maroof et al. [20] gave better DNA yield in terms of quality and quantity from the study plants. Hence, this method was considered for the purpose of standardization at varying concentration of Tris-HCL, -mercaptoethanol, NaCl, and PVP (Figure 1).


Genomic DNA isolated from plant leaves resolved under 0.8% agarose gel. Lane1 shows the DNA isolated by using Plant genomic DNA extraction Kit (GeNei) Lane2, Lane3, and Lane4 shows the isolated DNA by the CTAB method described by J. J. Doyle and J. L. Doyle [19] Porebski et al. [4] and Saghai-Maroof et al. [20] respectively. Lane5 to Lane8 represents the isolated DNA by the present optimized extraction method (Lane1 to Lane4 represents A. marina Lane5 represents the isolated DNA from salt marsh (Suaeda maritima) Lane6 and Lane7 illustrate the isolated genomic DNA from the fresh leaves of A. marina, whereas Lane8 represents the DNA isolated from dried leaves of A. marina).

The success of the optimized extraction method in obtaining high-quality genomic DNA from all the tested mangrove and salt marsh species demonstrated the broad applicability. DNA concentration of the extraction method ranged from 8.8 to 9.9 g L −1 . The use of prechilled mortar and pestle and −40°C/−80°C stored leaf sample successfully substituted the use of costly liquid nitrogen. The final DNA pellets were white with no visible discoloration. It has been reported that high level of -mercaptoethanol successfully removes the polyphenols [26]. Therefore, high concentration of β-mercaptoethanol was used which made the protocol good for extraction of high-quality DNA. The addition of NaCl at concentrations higher than 0.5 M, along with CTAB, is known to remove polysaccharides during DNA extraction [24, 27]. The concentration of NaCl varied with plant species in a range between 0.7 M [28] to 6 M [29]. In the present study, higher level of NaCl (1.5 M) in the extraction buffer further improved the quality of the extracted DNA. The high quality of obtained DNA could also be attributed to the use of a higher concentration of PVP (2.5%) with lower molecular weight (10,000) rather than 40,000. A number of workers [30, 31] have recommended the use of PVP with molecular weight of 10,000 at 2% (w/v) to address the problem of phenolics. PVP with low molecular weight has less tendency of precipitating with the nucleic acids as compared to PVP with high molecular weight thus yielding sufficient amount of polyphenol-free DNA [32].

Purity of extracted DNA was excellent as evident by A260/A280 ratio ranging from 1.78 to 1.84 and A260/A230 ratio was >2, suggesting that the preparations were sufficiently free of proteins and polyphenolics/polysaccharide compounds [20]. Clear banding patterns were observed in the RAPD study (Figure 2). The extracted DNA was also amenable for RFLP study and amplification of plant barcode genes as evident in Figures 3 and 4, respectively. The successfully amplified barcode genes sequences were sequenced and submitted to Genbank (Accession numbers: JQ433951, JQ421082, JQ511854, and JQ421083)


Concentration of DNA by isopropanol - Biology

Materials: see Solutions for Recipes

  1. Measure the volume of the DNA sample. Adjust the salt concentration by adding 1/10 volume of sodium acetate, pH 5.2, (final concentration of 0.3 M) or an equal volume of 5 M ammonium acetate (final concentration of 2.0-2.5 M). These amounts assume that the DNA is in TE only if DNA is in a solution containing salt, adjust salt accordingly to achieve the correct final concentration. Mix well. Add 2 to 2.5 volumes of cold 100% ethanol (calculated after salt addition). Mix well.
  2. Place on ice or at -20 degrees C for >20 minutes.
  3. Spin a maximum speed in a microfuge 10-15 min.Carefully decant supernatant. Add 1 ml 70% ethanol. Mix. Spin briefly. Carefully decant supernatant. Air dry or briefly vacuum dry pellet.
  4. Resuspend pellet in the appropriate volume of TE or water.

This Web page is maintained by Julie B. Wolf, UMBC
Last updated on 3/2/2010

is designed for students interested in careers in industrial and biomedical sciences.


Watch the video: 08 resuspending isopropanol pellet (September 2022).


Comments:

  1. Winfred

    It is a pity that I will not be able to participate in the discussion now. I don't have the information I need. But this topic interests me very much.

  2. Riggs

    Good question

  3. Kigazshura

    It's okay, it's the entertaining phrase

  4. Iccauhtli

    I do not have

  5. Aragis

    Please tell me - where can I find more information on this subject?

  6. Weldon

    Not a bad site, I found a bunch of necessary information

  7. Adnan

    Well done, this remarkable idea just needs to be said.



Write a message