Information

How can someone share 50% of their DNA with their parents yet all humans share 99.9%?


I have heard that humans share 99.9% of their DNA with other humans. I have also heard that a child shares 50% of their DNA with their parents. How do I resolve this apparent contradiction? It has been really bothering me.


It will be clear with a simple analogy.

You are 50% related to any one of your parent

Let's say you don't have any biology books. You have two friends, Alice and Bob. They each give you a copy of the book Campbell Biology. You now have two Campbell Biology. You have received 50% of your Campbell biology books from Alice and 50% from Bob.

Similarly, you inherit 50% of your DNA from your mother and 50% from your father. You are related at 50% to any one of them.

Two randomly sampled individual are 99.9% identical

Now consider the list of all the copies of Campbell Biology in the world. As there exist different editions, all Campbell Biology won't exactly be the same. Let's say you randomly sample two Campbell Biology from around the world and you align them letter by letter. What is the expected fraction of the letters that will be identical? If, for example you find the two sentences

Selection is a fitness variance associated to a genetic variance among individuals in a population.

and

Zelection is a fitnezz varianze azzociated to a genetic varianze among individualz in a populazion.

There are exactly 9 mismatches out of 99 characters, that is a 90% similitude.

Similarly, if you randomly sample two humans, align their DNA (a DNA sequence look likeATTTCGCTGTCGAATCGATCGGTA), you'll find that the fraction of mismatch is lower than 0.1%. Therefore, we all share 99.9% of our DNA.

Of course, alining DNA sequences (or normal sentences) is not quite that easy as some sequences (or sentence) can have more nucleotides (or letters) than others but I won't go into the details here.

How do these two measures relate?

Let's say that instead of giving you a book, Alice actually produced a copy of its book and gave it to you. The book you have received from Alice (that is 50% of all your Campbell Biology books) is 100% identical to Alice's book in term of mismatch.

Similarly, the 50% of your DNA that you inherit from your father (or mother) is 100% identical to the copy of the genome found in your mother.

Note however that

  1. Your mother probably made between 10 and 100 mutations when copying her DNA so that the DNA you received from your mother is not exactly 100% identical to your mother's DNA

    • Similarly Alice could have miscopied her Campbell Biology book that she passes to you
  2. Your mother actually recombined her two haplotypes

    • Similarly Alice actually had two different editions of Campbell Biology and she mixed them up a little bit before copying the resulting book!

The 99% and 50% refer to different senses of relatedness.

Humans share 99% of genes with other humans: If you were to compare one human to another human with respect to every single one of their genes, you would find a 99% similarity.

A child shares 50% of his or her genes with his or her parents: This 50% refers to a relatedness relative to the population rate of relatedness. It actually refers to a gene within that 1% that is different (a polymorphism) between humans. This is an approximation used in order to calculate what degree of prosociality an individual could be selected to impart to another individual, where the gene for prosociality would have some frequency between 0 and 1 (that is, there would be some difference between individuals at the locus where the gene is located). Hamilton's (1964) rule is used for this calculation. It is c < b*r, where c is the cost of the actor; b is the benefit to the recipient of the act; and r is the relatedness between the actor and recipient. The r used in this rule between parent and offspring is 0.5. The interpretation is that if a gene is responsible for a cost (c) to the holder of the gene (a parent) and a benefit to some other individual (an offspring), the relatedness (r) between the holder and the other individual must be greater than c/b because relatedness gives the likelihood that a copy of the gene responsible for the cost and benefit is also located in the benefiting individual and so the likelihood that the offspring shares a prosocial gene carried by a parent is half the difference between 1 and the background rate. If the gene is at 70% frequency in the population and one parent has the gene, then the offspring's likelihood of having the gene is 85% (assuming the other parent has it with 70% likelihood).


Are one's fingerprints similar to those of his or her parents in any discernable way?

Yes, there is an inheritable quality to fingerprints. Pattern types are often genetically inherited, but the individual details that make a fingerprint unique are not. Humans, as well as apes and monkeys, have so-called friction ridge skin (FRS) covering the surfaces of their hands and feet. FRS comprises a series of ridges and furrows that provide friction to aid in grasping and prevent slippage. FRS is unique and permanent--no two individuals (including identical twins) have the exact same FRS arrangement. Moreover, the arrangement of the ridges and features do not change throughout our lifetimes, with the exception of significant damage that creates a permanent scar. The term fingerprints refers to the FRS on the ends of our fingers.

Fingerprints have a general flow to the ridges that translates into one of three major pattern types: a whorl, loop or arch. It is possible to have just one, two or all three pattern types among your 10 fingerprints. The important thing to remember about pattern types is that an individual cannot be identified from fingerprints by pattern type alone. To make an identification, an examiner must look to the next level of detail: the specific path of ridges and the breaks or forks in the ridges, known as minutiae. Other identifying features such as creases, incipient ridges (nascent ridges found in the furrows) and the shapes of the ridge edges are also useful for identification purposes.

Early pioneers in the field of dermatoglyphics (the study of FRS patterns) demonstrated a strong correlation between the inheritance of fingerprint pattern and the overall size, shape and spacing of the ridges. The identifying ridge features, however, are not inheritable, which is what makes every fingerprint unique.

Why are patterns inherited, but not the identifying ridge features? The reason lies in the timing of fetal development: two critical events in the formation of FRS collide during weeks 10 through 15. Fetuses develop smooth volar pads--raised pads on the fingers, palms and feet--because of swelling mesenchymal tissue, which is a precursor of blood vessels and connective tissues. Around week 10, the volar pads stop growing but the hand continues to grow. As a result, over the next few weeks, the volar pad is absorbed back into the hand. During this critical stage, the first signs of ridges begin to appear on the skin of the volar pads.

The spacing and arrangement of these early ridges (known as primary ridges) is a random process, but it is dictated by the overall geometry and topography of the volar pad. If the primary ridges appear while the volar pad is still quite pronounced (a characteristic described as a high volar pad), then the individual will develop a whorl pattern. If the primary ridges appear while the volar pad is less pronounced (dubbed an intermediate volar pad), then the individual will develop a loop pattern. Finally, if the primary ridges appear while the volar pad is nearly absorbed (a so-called low volar pad), the individual will develop an arch pattern.

The timing of these two events (volar pad regression and primary ridge appearance) is genetically linked: pattern type is influenced by genetic timing (inherited from your mother and father). The exact arrangements of the ridges, minutiae and other identifying features, however, are random and not genetically linked (and thus not inheritable).

Evidence of this comes from studies of fingerprints from identical twins. Identical twins share the same DNA and, therefore, presumably the same genetic developmental timing. The fingerprints of identical twins often have very similar size and shape pattern types. The identifying characteristics are different, however. The table above lists the coefficients of correlation between size and shape of fingerprints found in one study.

This demonstrates that you are more likely to share pattern type with your family members than an unrelated individual, but your identifying FRS features will always be unique.


What is heritability?

Heritability is a measure of how well differences in people’s genes account for differences in their traits. Traits can include characteristics such as height, eye color, and intelligence, as well as disorders like schizophrenia and autism spectrum disorder. In scientific terms, heritability is a statistical concept (represented as h²) that describes how much of the variation in a given trait can be attributed to genetic variation. An estimate of the heritability of a trait is specific to one population in one environment, and it can change over time as circumstances change.

Heritability estimates range from zero to one. A heritability close to zero indicates that almost all of the variability in a trait among people is due to environmental factors, with very little influence from genetic differences. Characteristics such as religion, language spoken, and political preference have a heritability of zero because they are not under genetic control. A heritability close to one indicates that almost all of the variability in a trait comes from genetic differences, with very little contribution from environmental factors. Many disorders that are caused by mutations in single genes, such as phenylketonuria (PKU), have high heritability. Most complex traits in people, such as intelligence and multifactorial diseases, have a heritability somewhere in the middle, suggesting that their variability is due to a combination of genetic and environmental factors.

Heritability has historically been estimated from studies of twins. Identical twins have almost no differences in their DNA, while fraternal twins share, on average, 50 percent of their DNA. If a trait appears to be more similar in identical twins than in fraternal twins (when they were raised together in the same environment), genetic factors likely play an important role in determining that trait. By comparing a trait in identical twins versus fraternal twins, researchers can calculate an estimate of its heritability.

Heritability can be difficult to understand, so there are many misconceptions about what it can and cannot tell us about a given trait:

Heritability does not indicate what proportion of a trait is determined by genes and what proportion is determined by environment. So, a heritability of 0.7 does not mean that a trait is 70% caused by genetic factors it means that 70% of the variability in the trait in a population is due to genetic differences among people.

Knowing the heritability of a trait does not provide information about which genes or environmental influences are involved, or how important they are in determining the trait.

Heritable is not the same as familial. A trait is described as familial if it is shared by members of a family. Traits can appear in families for many reasons in addition to genetics, such as similarities in lifestyle and environment. For example, the language that is spoken tends to be shared in families, but it has no genetic contribution and so is not heritable.

Heritability does not give any information about how easy or difficult it is to change a trait. For example, hair color is a trait with high heritability, but it is very easy to change with dye.

If heritability provides such limited information, why do researchers study it? Heritability is of particular interest in understanding traits that are very complex with many contributing factors. Heritability can give initial clues as to the relative influences of “nature” (genetics) and “nurture” (environment) on complex traits, and it can give researchers a place to start teasing apart the factors that influence these traits.


Genes and Alzheimer's Disease

There are two types of Alzheimer's—early-onset and late-onset. Both types have a genetic component.

Late-Onset Alzheimer's Disease

Most people with Alzheimer's have the late-onset form of the disease, in which symptoms become apparent in their mid-60s and later.

Researchers have not found a specific gene that directly causes late-onset Alzheimer's disease. However, having a genetic variant of the apolipoprotein E (APOE) gene on chromosome 19 does increase a person's risk. The APOE gene is involved in making a protein that helps carry cholesterol and other types of fat in the bloodstream.

APOE comes in several different forms, or alleles. Each person inherits two APOE alleles, one from each biological parent.

  • APOE ε2 is relatively rare and may provide some protection against the disease. If Alzheimer's disease occurs in a person with this allele, it usually develops later in life than it would in someone with the APOE ε4 gene.
  • APOE ε3, the most common allele, is believed to play a neutral role in the disease—neither decreasing nor increasing risk.
  • APOE ε4 increases risk for Alzheimer's disease and is also associated with an earlier age of disease onset. Having one or two APOE ε4 alleles increases the risk of developing Alzheimer's. About 25 percent of people carry one copy of APOE ɛ4, and 2 to 3 percent carry two copies.

APOE ε4 is called a risk-factor gene because it increases a person's risk of developing the disease. However, inheriting an APOE ε4 allele does not mean that a person will definitely develop Alzheimer's. Some people with an APOE ε4 allele never get the disease, and others who develop Alzheimer's do not have any APOE ε4 alleles.

Recent research indicates that rare forms of the APOE allele may provide protection against Alzheimer’s disease. More studies are needed to determine how these variations might delay disease onset or lower a person’s risk.

Early-Onset Alzheimer's Disease

Early-onset Alzheimer’s disease is rare, representing less than 10 percent of all people with Alzheimer’s. It typically occurs between a person’s 30s and mid-60s. Some cases are caused by an inherited change in one of three genes.

The three single-gene mutations associated with early-onset Alzheimer’s disease are:

  • Amyloid precursor protein (APP) on chromosome 21
  • Presenilin 1 (PSEN1) on chromosome 14
  • Presenilin 2 (PSEN2) on chromosome 1

Mutations in these genes result in the production of abnormal proteins that are associated with the disease. Each of these mutations plays a role in the breakdown of APP, a protein whose precise function is not yet fully understood. This breakdown is part of a process that generates harmful forms of amyloid plaques, a hallmark of Alzheimer’s disease.

A child whose biological mother or father carries a genetic mutation for one of these three genes has a 50/50 chance of inheriting that mutation. If the mutation is in fact inherited, the child has a very strong probability of developing early-onset Alzheimer’s disease.

For other cases of early-onset Alzheimer’s, research has shown that other genetic components are involved. Studies are ongoing to identify additional genetic risk variants.

Having Down syndrome increases the risk of developing early-onset Alzheimer’s disease. Many people with Down syndrome develop Alzheimer’s as they get older, with symptoms appearing in their 50s or 60s. Researchers believe this is because people with Down syndrome are born with an extra copy of chromosome 21, which carries the APP gene.


Womb Wars

As anyone who took Biology 101 remembers, we’re all composites of our parents. Mom gives us 50 percent of our DNA and our dad fills in the other half. But only the students who were really paying attention are likely to recall that not all genes are expressed equally. In many mammals, the scales seem to be tipped toward fathers, whose genes often win the war underway in the womb.

This is due in part to the perplexing puzzle known as epigenetics. Basically, epigenetics influence the way your DNA is actually expressed. This can alter your dad’s sperm, which in turn may affect you. It can also affect the way the genes you have are read — and the proteins they produce — across your lifetime.

Take, for example, a 2015 study in Nature Genetics that showed the expression of thousands of different genes in mice varied depending on whether they came from a mom or a dad. While each parent technically contributed half of an offspring’s genome, approximately 60 percent of the dad’s genes were more expressive than the mom’s.

These epigenetic factors can play a role in numerous parts of your life, but they aren’t just about quirks like eye color or whether or not you can roll your tongue. Researchers think differential expression can also change your mental and physical wellbeing. If mom has a predisposition toward a given disease, you may still inherit it. But if your dad passes on genes that pass on an illness or a mutation of some kind, you may be more likely to be sick yourself, simply because his genes are more likely to be expressed.


The Problem With Incest

Mr. James Russell of Cashiers, North Carolina, recently justified meat-eating in the pages of Asheville Citizen-Times by arguing that humans are biologically classified as carnivores. His reasoning was simple. The consumption of animal flesh is morally right because it is natural.

Unfortunately, Mr. Russell got his facts wrong. Zoologists place humans in the order Primate (family Hominidea), not in the order Carnivora. Furthermore, like rats, humans are omnivores, not carnivores. But more troubling is Mr. Russell’s belief that humans should look to nature for moral guidance. He justifies meat-eating in humans on the grounds that other animals eat one another. I suspect, however, that he does not approve of gang rape, adultery, cannibalism, and the consumption of feces, all of which are practiced in nature by our four-legged brethren. While moral codes exist in other species (see here), humans have the capacity—and, indeed, the responsibility—to operate on a higher ethical plane.

The (Nearly) Universal Taboo

On matters of morality, I generally agree with Katherine Hepburn who quipped to Humphrey Bogart in The African Queen, "Nature is what we are put in this world to rise above." There is, however, an exception to my contention that humans should not turn to nature for moral guidance. It is the rule that says: “Don’t have sex with first-degree relatives.” First-degree relatives are the individuals you share 50 percent of your genes with—your parents, children, and siblings. Indeed, non-human animals have evolved a host of strategies to prevent incest (here). Even plants possess anti-incest mechanisms (here).

As University of Miami psychologists Debra Lieberman and Adam Smith pointed out in a recent article in the journal Current Directions in Psychological Science, humans have social and psychological mechanisms to deter incest. With very few exceptions, marriages between brothers and sisters and between parents and their children are verboten in every human culture. The primary psychological anti-incest mechanism is the yuck response. Even the idea of sex with mom or dad or bro or sis is upsetting to most people. The psychologist Jonathan Haidt has found that nearly everyone is repelled by the prospect of brother-sister sex, even in hypothetical situations in which there is no chance of pregnancy (here).

The Biological Cost of Incest

This raises an interesting question: Just what’s so bad about incest? Sure, having sex with your dad or your sister seems gross. But why? Some anthropologists have argued that incest taboos are learned social conventions. This explanation, however, doesn’t make sense to me as it does not explain the widespread existence of anti-incest mechanisms in creatures ranging from cockroaches to chimpanzees (here). Second, the incest taboo is about as close to a universal law as human moral rules get.

Why should mechanisms for avoiding incest be so widespread both in nature and across human societies? The answer is simple. The problem with having sex close with relatives is that there is an astonishingly high chance that your offspring will be born with a serious birth defect. Take the results:

Percent of children with severe birth defects.

Source: A study of Czechoslovakian children whose fathers were first-degree relatives. Fewer than half of the children who were the product of incestuous unions were completely healthy. Forty-two percent of them were born with severe birth defects or suffered early death and another 11 percent mildly impaired mentally. This study is particularly instructive as it included a unique control group—the offspring of the same mothers but whose fathers were not the mothers’ relatives. When the same women were impregnated by a non-relative, only 7 percent of their children were born with a birth defect (Figure 1).

A group of genetic counselors reviewed the research on the biological consequences of sex between relatives (consanguineous relationships) (here). They found a surprisingly small increase (about 4 percent) in birth defects among the children of married cousins. Incest between first-degree relatives, however, was a different story. The researchers examined four studies (including the Czech research) on the effects of first-degree incest on the health of the offspring. Forty percent of the children were born with either autosomal recessive disorders, congenital physical malformations, or severe intellectual deficits. And another 14 percent of them had mild mental disabilities. In short, the odds that a newborn child who is the product of brother-sister or father-daughter incest will suffer an early death, a severe birth defect or some mental deficiently approaches 50 percent.

Foolish Consistencies and Little Minds

The profound negative effects of incest on unborn children raise the issues of moral consistency and of abortion politics. I understand the pro-life argument. If you believe that human life begins at the moment sperm meets egg, it is perfectly logical to oppose abortion. But at what point do reasonable people temper logical consistency with compassion and common sense?

During the 2012 Republican Party convention in Tampa, the Platform Committee struggled with an aspect of the argument against legal abortion. Just about everyone on the committee agreed that abortion should be banned. But committee members were split over whether official party doctrine should include exceptions to the abortion ban if a fetus was the result of rape or incest. In the end, ideological purity prevailed. The official Republican platform states, “We assert the inherent dignity and sanctity of all human life and affirm that the unborn child has a fundamental individual right to life which cannot be infringed.” No exceptions, period. Even in cases of first-degree relative incest.

I grudgingly admit that the lack of any exception in the official Republican position on abortion is logically consistent with the party's statement on the “sanctity of all human life.” But shouldn't logic sometimes be tempered with compassion? Emerson famously wrote, “A foolish consistency is the hobgoblin of little minds, adored by little statesmen and philosophers and divines.”

Forcing a woman burdened with the psychological scars of incest to bear a child who has a roughly 50:50 chance of having mental disabilities or a severe birth defect is perhaps the ultimate example of a foolish consistency that appeals to little statesmen.


One of our blog followers, Ron, asked this question:

“My late father and his brother were born and raised on Hatteras Island which was a very isolated community until relatively recent times. Curious about their genetic ancestry, I had my uncle do the Family Tree DNA Family Finder test. His results for the Family (Population) Finder were:

Europe (Western European) – Orcadian 91.37% ±2.82%

Middle East – Palestinian, Bedouin, Bedouin South, Druze, Jewish, Mozabite 8.63% ±2.82%

The 8.63% Middle East was surprising since most if not all of his ancestors, going back 4 or more generations, were born on the OBX (Outer Banks). Most of the original families on Hatteras Island trace their roots back to the British Isles and western Europe.

Since my mother’s parents were immigrants from eastern Europe, I thought it would be interesting to know what contributions my maternal grandparents added to my genetic ancestry, so I submitted my DNA samples for the same test. The Population Finder test showed that I was Europe Orcadian 100.00% ±0.00%. I was shocked that some other population did not show in the results.

Can you help me understand how the representative populations are determined and why Middle East didn’t show in my sample?”

Yes, indeed, the dreaded “Middle Eastern” result. I’ve seen this over and over again. Let’s talk about what this is and why it might happen. As it happens, the fact that Ray is from Hatteras Island provides us with a wonderful research opportunity, because it’s a population I’m quite familiar with.

Given that Dawn Taylor and I administer the Hatteras Families DNA Projects (Y-line, mtDNA and autosomal), I have a good handle on the genealogy of the Hatteras Island Families. They are of particular interest because Hatteras Island is where Sir Walter Raleigh’s Lost Colonists are rumored to have gone and amalgamated with the Hatteras Indians. The Hatteras Indians in turn appear to have partly died off, and partly married into the European Island population. Both the Lost Colony Project and the Hatteras DNA Projects at http://www.familytreedna.com/public/HatterasFathers and http://www.rootsweb.ancestry.com/

molcgdrg/hatteras/hifr-index.htm are ongoing and all Hatteras families are included.

As part of the Hatteras families endeavor, Dawn and I have assembled a data base of the Hatteras families with over 5000 early settlers and their descendants to about the year 1900 included. What Ron says is accurate. Most of the Hatteras Island families settled on the island quite early, beginning about 1710. Nearly all of them came from Virginia, some directly and others after having settled on the NC mainland first for a generation or so in surrounding counties. By 1750, almost all of the families found there in 1900 were present. So indeed, this isolated island was settled by a group of people from the British Isles and a few of them intermarried with the local population of Hatteras Indians.

Once on the island, it was unusual to marry outside of the island population, so we have the situation known as endogamy, which is where an isolated population marries repeatedly within itself. Other examples of this are the Amish and Jewish populations. When this happens, the founding group of people’s DNA gets passed around in circles, so to speak, and no new DNA is introduced.

Typically what happens is that in each generation, 50% “new” DNA is introduced by the other parent. When the new DNA is from someone nonrelated, it’s relatively easy to sort out using today’s DNA phasing tools. But when the “new” DNA isn’t new at all, but comes from the same ancestral stock as the other parent, it has the effect of making relationships look “closer” in time.

You carry the following average percentages of DNA from these relatives:

  • Parents 50% from each parent
  • Grandparents 25%
  • Great-grandparents 12.5%
  • Great-great-grandparents 6.5%

As you can see, the percentage is divided in each generation. However, if two of your great-grandparents are the same person, then you actually carry 25% of the DNA from that person, not 12.5. When you’re looking at matches to other people in an endogamous community, nearly everyone looks more closely related than they are on paper due to the cumulative effect of shared ancestors. In essence, genetically, they are much closer than they look to be on a genealogy pedigree chart.

Ok, back to the question at hand. Where did the Middle Eastern come from?

Looking at the percentages above, you can see that if Ray’s Uncle was in fact 8% (plus or minus about 2%, so we’ll just call it 8%) Middle Eastern, his Middle Eastern relative would be either a great-grandparent or a great-great-grandparent. Given that generational length is typically 25 to 30 years, assuming Ray’s birth in 1960 and his uncles in 1940, this means that this Middle Eastern person would have been living on Hatteras Island between 1835 and 1860 using 25 year generations and between 1810 and 1840 using 30 year generations. Having worked with the original records extensively, I can assure you that there were no Middle Eastern people on Hatteras Island at that time. Furthermore, there were no Middle Eastern people on Hatteras earlier in the 1800s or in the 1700s that are reflected in the records. This includes all existent records, deed, marriages, court, tax, census, etc.

What we do find, however, are both Native Americans, slaves and free people of color who may be an admixture of either or both with Europeans. In fact, we find an entire community adjacent to the Indian village that is admixed.

We published an article in the Lost Colony Research Group Newsletter that discusses this mixed community when we identified the families involved. It’s titled, “Will the Real Scarborough, Basnett and Whidbee Please Stand Up” and details our findings.

These families were present on the island and were recorded as being “of color” before 1790, so the intermarriage occurred early in the history of the island.

Furthermore, these families continued to intermarry and they continued to live in the same community as before. In fact, in May and June of 2012, we visited with a woman who still owns the Indian land sold by the Indians to her family members in 1788! And yes, Ray’s surname is one of the surnames who intermarried with these families. In fact, it was someone with his family surname who bought the land that included the Indian village in 1788 from a Hatteras Indian woman.

So what does this tell us?

Having worked with the autosomal results of people who are looking for small amounts of Native American ancestry, I often see this “Middle Eastern” admixture. I’ve actually come to expect it. I don’t believe it’s accurate. I believe, for some reason, tri-racial admixture is being measured as “Middle Eastern.” If you look at the non-Jewish Middle East, this actually makes some sense. There is no other place in the world as highly admixed with a combination of African, European (Caucasian) and Asian. I’m not surprised that early admixture in the US that includes white, African and Native American looks somewhat the same as Middle Eastern in terms of the population as a whole. Regardless of why, this is what we are seeing on a regular basis.

New technology is on the horizon which will, hopefully, resolve some of this ambiguous minority admixture identification. As new discoveries are made, as we discussed when we talked about “Ethnicity Finders” in the blog a few days ago, we learn more and will be able to more acutely refine these minority amounts of trace admixture.

If Ray’s ancestor in 1750 was a Hatteras Indian, and if there was no Lost Colonist European admixture already in the genetic mix, then using a 25 year generation, we would see the following percentages of ethnicity in subsequent generations, assuming marriage to a 100% Caucasian in each generation, as follows:

  • 1750 – 100% Indian
  • 1775 – next generation, married white settler – 50% Indian
  • 1800 – 25% Indian
  • 1825 – 13.5% Indian
  • 1850 — 6.25% Indian
  • 1875 — 3.12% Indian
  • 1900 – 1.56% Indian
  • 1925 – 0.78% Indian
  • 1950 – 0.39% Indian

Remember, however, about endogamy. This group of people were neighbors and lived in a relatively isolated community. They married each other. Every time they married someone else who descended from someone who was a Hatteras Indian in 1750, their percentage of Native Heritage in the subsequent generation doubled as compared to what it would have been without double inheritance. So if Ray’s Uncle is descended several times from Hatteras Indians due to intermarriage within that community, it’s certainly possible that he would carry 6-10% Native admixture. There are also records that suggest possible African admixture early in the Native community.

So now to answer Ray’s last question about inheritance.

Ray wanted to know why he didn’t show any “Middle Eastern” admixture when his uncle did.

Remember that Ray’s Uncle has two “genetic transmission events” that differ from Ray’s line. Ray’s Uncle, even though he had the same parents as Ray’s father, inherited differently from his parents. Children inherit half of their DNA from each parents, but not necessarily the same half. Maybe Ray’s father inherited little or none of the Native admixture. In the next generation, Ray inherited half of his father’s DNA and half of his mother’s. We have no way of knowing in which of these two transmission events Ray lost the Native admixture, or whether it’s there, but in such small pieces that the technology today can’t detect it.

Hopefully the new technology on the horizon will improve all aspects of autosomal admixture analysis and ethnicity detection. But for today, if you see the dreaded “Middle East” result appear as one of your autosomal geographic locations and your family isn’t Jewish and has been in the states since colonial times, think to yourself ‘racial admixture’ and revisit this topic as the technology improves. In other words, as far as I’m concerned, the jury is still out!

I receive a small contribution when you click on some of the links to vendors in my articles. This does NOT increase the price you pay but helps me to keep the lights on and this informational blog free for everyone. Please click on the links in the articles or to the vendors below if you are purchasing products or DNA testing.


Examples of Heteropaternal Superfecundation

One way heteropaternal superfecundation could occur is if a woman has sexual intercourse with two different men within the same timeframe that both embryos are conceived. For example, in New Jersey, a mother of twins underwent paternity testing when applying for public assistance. After the test showed that her partner was only the father of one of her twins, she admitted that she had had sex with another man within the same week that her twins were conceived.

Similarly, a mother of twins in Texas acknowledged that she was having an affair with another man when her twins were conceived.   Paternity testing revealed that her fiancee was indeed the father of one of the twin boys, but that another man was the biological father of the other twin.

While we might assume all instances of twins with different fathers are the result of the mother having sexual intercourse with different partners, this isn't the only scenario in which it could happen. This situation can also occur when twins are the result of fertility treatments. For example, in a mixup at a lab, equipment had been used twice, causing another man’s sperm to be mixed with that of the intended father resulting in Dutch twin boys conceived through in vitro fertilization (IVF) with different fathers.  


13 Rare Genetic Disorders And How They Are Inherited

A genetic disorder, in layman’s terms, is a serious medical condition triggered by irregularities in the genome (gene) which can either be hereditary (inherited from parents) or caused by new alterations to the DNA.

They can be divided into two broad classes single-gene and multiple gene disorders. In a single-gene disorder, also known as monogenic, only a particular gene is mutated or permanently altered.

Most metabolic disorders are caused by single-gene defects. On the other hand, multi-gene disorders are more complex and include more than one faulty gene. They are generally difficult to predict and are largely influenced by environmental factors.

While not all genetic disorders are fatal or directly lead to death, there are currently no known remedies to cure such diseases. Below, we have compiled a list of rare genetic disorders known to us. We have also mentioned how these genetic disorders are inherited.

13. DiGeorge Syndrome

An infant with DiGeorge Syndrome Image courtesy: National Center for Biotechnology Information

Inheritance Pattern: Autosomal dominant (only one affected parent)

22q11.2 deletion syndrome, more commonly known as DiGeorge syndrome is a relatively rare genetic disorder caused by defective chromosome 22. Basically, a small section of chromosome 22 containing about 30 genes is deleted from the DNA.

Symptoms include facial deformities, congenital heart defects (present from birth), along with kidney problems and hearing loss. Patients suffering from this anomaly are likely to have at least one autoimmune disorder and a higher risk of developing Parkinson’s and Schizophrenia.

It was first discovered and documented by physician Angelo DiGeorge in 1968. Its genetic component, however, was not studied until 1981. DiGeorge syndrome affects roughly about 1 in every 4000 people worldwide though it might be more common.

12. Tuberous Sclerosis Complex

Inheritance Pattern: Autosomal dominant

Tuberous Sclerosis Complex (TSC for short) is a single-gene disorder that causes non-cancerous tumors (benign) to develop in multiple organs including liver, lungs, brain, kidneys, skin, and heart. This rare condition is caused by mutations in any one of the two tumor suppressors genes namely TSC1 and TSC2. Don’t confuse it with Tuberculosis (TB).

The most common symptoms of tuberous sclerosis include severe neurological problems such as seizures, intellectual disability, autism, and other neurodevelopmental disorders along with different types of tumors in the aforementioned organs. In rare cases, it can also mess with the pancreas causing pancreatic neuroendocrine tumors.

Most of the TSC cases result from random genetic mutations rather than inheritance. TSC is generally difficult to diagnose since it affects almost all major human organs and has no clear symptoms.

11. Ehlers–Danlos Syndromes

Image Courtesy: Piotr Dołżonek

Inheritance pattern: Autosomal dominant/recessive

Ehlers-Danlos syndromes (EDS) are a group of well-documented genetic disorders associated with connective tissue. The most common symptoms, which are consistent with EDS are stretchy skin, abnormally flexible joints (hypermobility) and scars. Other medical conditions such as scoliosis and early-onset osteoarthritis may also arise.

This genetic condition can be triggered by a mutation in one of nearly a dozen genes. So far, about 13 different sub-types of EDS’ have been recognized. Out of those 13, only two, namely Arthrochalasia EDS and Dermatosparaxis EDS are considered to be extremely rare with just 30 and 10 reported cases respectively.

Patients suffering from Arthrochalasia EDS usually experience congenital hip dysplasia, joint hypermobility, scoliosis, bone loss, and skin problems. Ehlers-Danlos syndromes can either be inherited or caused by new mutations.

10. Hereditary Coproporphyria

Inheritance Pattern: Autosomal dominant

Hereditary coproporphyria (HCP) belongs to a group of acute porphyrias which primarily affects the central nervous system. Individuals suffering from hereditary coproporphyria experience acute episodic attacks involving seizures, severe abdominal pain, high blood pressure, and an abnormal heart rate. Other symptoms include nausea, fragile skin, and scarring.

These attacks are triggered by alcohol, hormonal and lifestyle changes, and can also be chemically induced. Without any triggers, many affected individuals may even go asymptomatic (without signs).

HCP is caused by a deficiency of an enzyme known as coproporphyrinogen oxidase which is caused by mutations in the CPOX gene. In general, porphyrias are rare and have an estimated rate of occurrence (all forms) of about 1 in 20,000.

9. Myoclonic Epilepsy with Ragged Red Fibers

ragged red fibers in muscle fibers (MERRF syndrome)

Inheritance Pattern: Mitochondrial inheritance (maternal)

Mitochondrial DNA is an essential part of the human genome. They are located inside mitochondria, which, as you may know, are practically the powerhouses of individual cells.

Any abnormality in cells can trigger one of many mitochondrial diseases which are mostly inherited and often manifest themselves in various metabolic and neurological disorders. One such mitochondrial disease is myoclonic epilepsy with ragged red fibers or MERRF for short which is extremely rare.

This condition has severe effects on the nervous system and muscles, though it affects most of the body. Most often a person with MERRF show involuntary twitching (myoclonus) as the first symptom, then present with seizures and ataxia (when the brain starts to lose control of the body).

As with other genetic disorders, the actual mechanism behind MERRF is not properly understood but the mutation to the mitochondrial genomes (mitochondrial DNA or nuclear DNA) is understood to be central to this. A distinct physical characteristic of the MERRF is ragged red fibers (dead mitochondria) that accumulate in muscle fiber and are visible on muscle biopsy.

8. Chronic Granulomatous Disease

Microscopic view of granuloma

Inheritance Pattern: Autosomal recessive, X-linked

Chronic granulomatous disease (CGD) is a genetic condition in which the immune system is unable to fend-off invading pathogens completely, making the affected individual vulnerable to all sorts of bacterial and fungal infections.

The disease basically interferes with white blood cell’s ability to produce oxygen compounds necessary for killing harmful organisms. Instead, the immune system forms granulomata (plural for granuloma) in different parts of the body to wall off the bacteria.

CGD is most likely to be caused by mutations on the X chromosome, but alterations on chromosome 7 (CYBA gene) and 16 (NCF1 gene) have also been linked to the genetic condition.

In a handful of cases, a CGD patient may also carry another extremely rare genetic disease known as McLeod syndrome. This is due to the close proximity of genes associated with the two conditions.

7. Von Hippel–Lindau Disease

Inheritance Pattern: Autosomal dominant

von Hipple-Lindau syndrome (VHL) is a rare genetic disorder that affects multiple organ systems in our body. A person suffering from this condition usually presents with cysts and benign tumors (with the potential to transform into a malignant form) in various body parts, including the nervous system (hemangioblastomas), kidneys, uterus, and pancreas.

This condition is triggered by mutations in a particular tumor suppressor gene (located in chromosome 3) bearing an identical name. About 80% of VHL cases are inherited, while the rest are caused by ‘new’ mutations. Globally, the incidence rate of von Hippel-Lindau syndrome is about 1 in 36,000 live births.

Back in 2007, researchers at the Vanderbilt university speculated that VHL may have played a significant role in the legendary Hatfield-McCoy rivalry after some members of the McCoy blood-line have been diagnosed with von Hipple-Lindau. Pheochromocytomas (tumor in the adrenal gland), which is caused by VHL could explain their short temper, rage and violent outbursts.

6. Cryopyrin-associated Periodic Syndrome

Inheritance Pattern: Autosomal dominant

Cryopyrin-associated periodic syndrome (CAPS for short) is a group of clinically overlapping autoinflammatory diseases (faulty innate immune system) including the Muckle-Wells syndrome, neonatal-onset multisystem inflammatory disease, and familial cold autoinflammatory syndrome, all of which share the same pathology and triggered by mutations in a particular gene.

Fever is the most common symptom among CAPS patients along with fatigue, mood swings, rash, and depression. It can also cause visual and hearing impairment along with various musculoskeletal problems including arthritis and bone deformity. In extremely rare cases, CAPS can cause abnormal proteins to build in multiple organ tissues (AA amyloidosis).

Mutations in the NLRP3 gene (located in chromosome 3) is known to be the root cause of CAPS. The particular gene is responsible for encoding cryopyrin protein, an essential component of the innate immune system responsible for recognizing the pathogen-associated molecular pattern.

5. Wiskott–Aldrich Syndrome

Inheritance Pattern: X-linked recessive (both parents must be a carrier)

Wiskott-Aldrich syndrome (WAS) is a rare x-linked recessive condition that usually affects only males. The most common symptoms are small red spots on the skin (broken blood vessels) and easy bruising due to low platelet counts, dermatitis, and bloody diarrhea. Most WAS patients are likely to develop at least one autoimmune disorder and blood-related cancer.

This condition is caused by mutations in WAS gene located on the X chromosome. A couple of other rare genetic disorders have also been linked to mutations in the aforementioned gene.

Treatments for WAS are currently symptom(s) based i.e treating symptoms as they arise. Regular intravenous immunoglobulins (IVIG) and blood transfusion can help patients. In the United States, this genetic condition affects 1 in about 250,000 live births.

4. Harlequin-type ichthyosis

Harlequin fetus

Inheritance Pattern: Autosomal recessive

Harlequin-type ichthyosis or simply Harlequin ichthyosis is a life-threatening genetic condition in which infants are born with hard, diamond-shaped skin plates that are separated by large cracks. A healthy skin basically acts like a protective barrier that stops hostile microbes from entering our body while keeping important fluids inside.

The extreme skin condition in harlequin ichthyosis, however, disrupt this balance, making affected individuals maintain body temperature, water and susceptible to infections. It also limits the movement of the limbs and legs. Restricted movement of the chest can lead to breathing difficulties. Infants affected with Harlequin-type ichthyosis are likely to die within one month of their birth.

Harlequin ichthyosis is extremely rare and though its exact occurrence rate is not known, it’s estimated to affect about 1 in every 300,000 live births.

3. Tay–Sachs Disease

Inheritance Pattern: Autosomal recessive

Tay-Sachs is a fatal (in most cases) genetic disorder in which nerve cells present in the spinal cord and the brain are rapidly destroyed. This extremely rare genetic anomaly is caused by mutations in the HEXA gene located on chromosome 15.

Based on its time of onset, the disease can be classified into three types, the most common and perhaps the most lethal being infantile Tay–Sachs disease which usually starts showing signs in infants six months after their birth. Symptoms include a rapid decline in physical and mental abilities, blindness and muscle stiffness. The other two forms of Tay-Sachs are rarer and are not life-threatening.

In the United States, Tay-Sachs disease affects nearly about 1 in 320,000 individuals. However, it has an exceptionally high incidence rate among Ashkenazi Jews which is around 1 in every 3,500 live births.

2. Proteus Syndrome

Left to right: A kid with Proteus syndrome graphical illustration of the condition

Proteus syndrome is an extremely rare genetic condition that involves abnormal growth of bones, skin, blood vessels and fatty tissues. It’s progressive in nature means a person is normally born without any visible deformities. Proteus syndrome patients generally develop bone and skin tumors and have unique skeletal malformations including inconsistency in limb length and spinal deformity.

According to a study conducted in 2011, alterations in AKT1 gene (located in chromosome 14) can trigger this condition. There are just over 200 confirmed cases of Proteus syndrome worldwide, however, the number doesn’t include people who go undiagnosed.

1. Fibrodysplasia ossificans progressiva

Inheritance Pattern: Autosomal dominant

Fibrodysplasia ossificans progressiva (FOP) is perhaps one of the rarest known diseases that affect humans. It messes up the body’s skeletal repair mechanism and puts it into overdrive. The disorder causes muscles, ligaments, and tendons to slowly turn into bone (ossification). Formation of extra-skeletal bone trigger gradual loss of mobility which can lead to further complications.

People suffering from FOP are born with malformed big toes (for unknown reasons) and may also have abnormally short thumbs. The usual onset is before age of 10 when lumps started to become visible around the neck, shoulders and then spread throughout the body.

Muscle injuries, trauma or surgical attempts to remove a bone overgrowth are more likely to aggravate the situation by triggering more rapid ossification in the affected area. Due to its extreme rarity and muscle involvement, Fibrodysplasia ossificans progressiva is often misdiagnosed either as cancer or fibrosis.

Almost all known cases of FOP are caused by new mutations and are not genetically inherited. Alterations in the gene ACVR1 is understood to be the root cause of this disease.

Bipro Das

Biprojit has been a staff writer at RankRed since 2015. He mainly focuses on game-changing inventions but also covers general science with a particular interest in astronomy. His domain extends to mobile apps and knows a thing or two about finance. Biprojit has a Bachelor of Arts degree from the University of Delhi, majoring in Geography.

Related articles


Support for Families and Alzheimer's Disease Caregivers

Caring for a person with Alzheimer’s disease can have high physical, emotional, and financial costs. The demands of day-to-day care, changes in family roles, and decisions about placement in a care facility can be difficult. There are several evidence-based approaches and programs that can help, and researchers are continuing to look for new and better ways to support caregivers.

Becoming well-informed about the disease is one important long-term strategy. Programs that teach families about the various stages of Alzheimer’s and about ways to deal with difficult behaviors and other caregiving challenges can help.

Good coping skills, a strong support network, and respite care are other ways that help caregivers handle the stress of caring for a loved one with Alzheimer’s disease. For example, staying physically active provides physical and emotional benefits.

Some caregivers have found that joining a support group is a critical lifeline. These support groups allow caregivers to find respite, express concerns, share experiences, get tips, and receive emotional comfort. Many organizations sponsor in-person and online support groups, including groups for people with early-stage Alzheimer’s and their families.